Transcript asmbl_16225

Sequence
Transcript Sequence for observation asmbl_16225 of TGE0032163:
GTGAAAGCGAAAGCTGGGGCTGCTAGCCCAGGCTCGAGAGCTGCCAAGTGGGGGGAAGCATGGCCAAGCCTTGTGGGGTCCGCTTGAGTGGAGAAGCCCGAAAACAGGTGGATGTCTTCAGACAAAATCTTTTCCAGGAGGCTGATGACTTCCTCTGCACTTTCTTGCCACGGAAAATCATATCCCTGAGTCAGCTCTTGCAGGAGGATTCCCTCAATGTGGCCGACCTCTCCTCCCTCCGGGCTCCTCTGGACATCCCTATCCCAGATCCTCCACCCAAGGATGACGAGATGGAAACAGACAAGCAGGAGAAGAAGGAAGTCCCTAAGTGTGGCTACCTCCCGGGGAACGAGAAGCTTCTGGCCTTGCTCGCTTTGGTTAAGCCAGAAGTCTGGACTCTCAAAGAGAAGTGCATTCTGGTAATCACATGGATCCAGCACCTGATCCCCAAGATTGAGGATGGAAATGATTTTGGGGTGGCAATTCAGGAGAAGGTGCTGGAGAGAGTGAATGCTGTCAAGACCAAAGTAGAAGCTTTCCAGACAACCATTTCCAAGTACTTCTCAGAACGAGGGGACGCTGTAGCCAAGGCTTCCAAGGACACCCATGTAATGGATTACCGGGCCTTGGTGCATGAGCGAGATGAAGCAGCCTATGGGGCGCTTAGGGCCATGGTGCTGGACCTGAGGGCCTTCTATGCTGAGCTTTATCATATCATCAGCAGCAACCTAGAGAAAATCGTCAACCCGAAGGGTGAAGAAAAGCCATCGATGTACTGAGCTAAGGATTAGA