Transcript asmbl_16106

Sequence
Transcript Sequence for observation asmbl_16106 of TGE0032154:
CGGCCGAGGTGCGCGCTGGTGGGGAGGGGGGGCCTGAGAGGAGCATGAATGGAGCAAAATGGCGGATCATGTGCAGAGCCTGGCCCAACTAGAGAATCTGTGCAAACAGTTGTATGAAACAACAGATACAACCACTCGACTGCAGGCAGAGAAAGCCTTGGTTGAATTCACCAACAGCCCTGATTGCCTGAGCAAGTGCCAGCTGCTCCTCGAGAGAGGAAGTTCGTCCTACTCCCAGCTGCTGGCAGCTACATGCCTTACCAAGCTCGTGTCTCGGACAAACAACCCCTTGCCACTGGAGCAGCGGATAGATATCCGGAACTATGTGCTCAACTACCTTGCCACTCGGCCAAAGTTGGCAACTTTCGTGACTCAAGCCCTCATCCAGCTGTATGCCAGGATCACAAAGCTGGGCTGGTTTGACTGCCAGAAGGATGACTATGTCTTCAGAAACGCAATCACAGACGTCACAAGGTTCCTGCAGGACAGTGTTGAATACTGCATCATTGGCGTCACAATTTTATCTCAGCTCACCAATGAAATTAATCAAGCAGACACAACTCATCCTTTAACCAAACACAGAAAAATAGCCTCTTCTTTCCGAGACTCATCACTGTTTGATATCTTCACACTTTCCTGCAATTTACTAAAACAGGCATCAGGAAAGAATCTGAACTTGAATGATGAAAGTCAGCATGGCTTGCTAATGCAACTGCTCAAACTCACCCACAACTGTCTGAACTTTGATTTTATCGGCACATCTACTGATGAGTCCTCAGACGACCTGTGTACAGTGCAGATCCCCACCAGCTGGAGATCAGCATTCTTAGATTCTTCGACTCTGCAGCTGTTTTTTGACCTGTATCATTCCATTCCTCCCTCGTTCTCACCTTTGGTATTGTCCTGCTTAGTACAGATTGCCTCAGTCCGGAGATCCCTATTTAACAATGCTGAGAGGGCCAAGTTTCTCTCTCATCTTGTTGATGGTGTTAAACGAATACTGGAAAATCCACAGAGTTTATCAGACCCAAACAATTACCATGAGTTCTGCAGACTACTGGCTCGGTTAAAGAGTAACTACCAACTGGGAGAACTGGTAAAAGTGGAAAACTACCCTGATGTTATCCGATTGATAGCCAACTTCACAGTGACCAGCCTACAGCACTGGGAATTTGCCCCAAATAGTGTGCACTATCTCCTGAGCCTATGGCAGCGGCTGGCAGCCTCTGTACCATATGTCAAAGCCACAGAGCCCCATATGCTGGAAACATATACTCCTGAGGTTACCAAAGCCTATATCACATCCCGCTTGGAATCTGTGCACATCATTCTGAGGGATGGCCTGGAAGATCCCCTGGAAGATACAGGTCTGGTCCAGCAACAGCTGGACCAGCTGTCCACCATCGGGCGTTGTGAGTATGAGAAGACATGCGCGCTCCTTGTGCAGCTATTTGACCAGTCGGCCCAGTCGTACCAAGAACTGCTGCAGAGTGCCAGTGCCAGCCCAATGGACATTGCAGTGCAGGAGGGACGACTGACGTGGTTAGTCTATATCATTGGAGCTGTGATTGGTGGCCGAGTTTCTTTTGCCAGCACTGATGAGCAAGATGCAATGGATGGTGAGCTTGTCTGTCGGGTGCTCCAGCTTATGAACCTGACAGATTCCCGCTTGGCTCAGGCTGGTAATGAGAAGCTTGAATTGGCCATGCTGAGTTTTTTTGAGCAGTTTCGTAAGATCTACATTGGGGATCAGGTGCAGAAATCCTCAAAGCTGTACCGCCGACTCTCAGAAGTTCTGGGATTGAATGACGAGACGATGGTGCTGAGTGTCTTCATAGGAAAAGTCATCACCAACTTGAAGTACTGGGGTCGTTGTGAGCCAATCACCTCCAAGACACTGCAGCTCCTCAATGACCTCTCCATCGGATACAGTAGCGTAAGGAAGTTAGTGAAGCTTAGCGCTGTACAGTTCATGCTGAACAATCACACGAGCGAGCACTTTTCATTTTTGGGTATTAACAATCAGTCCAACCTGACAGACATGCGGTGTCGGACTACCTTCTACACAGCACTTGGGCGTCTCCTCATGGTGGATTTAGGAGAGGATGAAGATCAGTATGAACAATTCATGCTTCCTCTAACAGCAGCGTTTGAGGCTGTGGCCCAGATGTTCAGCACTAACAGCTTCAATGAACAGGAGGCAAAGAGAACTCTGGTTGGCCTAGTGAGAGACCTGAGAGGGATAGCCTTTGCCTTCAATGCCAAGACCAGTTTCATGATGCTCTTCGAATGGATATACCCCTCCTACATGCCAATTCTCCAGCGGGCAATTGAGCTCTGGTACCATGACCCAGCCTGTACCACTCCTGTGCTCAAGCTGATGGCTGAATTAGTTCATAACAGATCTCAGCGACTCCAATTTGATGTTTCATCTCCCAATGGTATCTTACTTTTCCGAGAAACCAGCAAGATGATAACAATGTATGGCAATCGCATCCTGACACTAGGAGAGGTGCCAAAGGATCAGGTCTATGCTTTGAAGCTCAAGGGTATCTCCATCTGCTTCTCCATGCTGAAGGCTGCCCTCAGTGGGAGTTATGTCAACTTTGGGGTCTTCCGTCTCTATGGAGATGATGCCTTGGAAAATGCCCTACAGACCTTCATCAAACTACTCCTCTCTATTCCTCATAGTGACCTCCTGGATTACCCCAAGCTCAGCCAGTCTTACTACTCACTACTGGAAGTCCTGACCCAGGACCATATGAACTTTATTGCAAGCCTGGAACCTCATGTCATCATGTACATCCTCTCTTCTATTTCTGAAGGACTTACTGCACTTGACACCATGGTATGCACGGGCTGCTGTTCCTGCCTAGACCATATTGTGACGTATCTCTTCAAACAGCTGTCACGGAGCACCAAGAAAAGGACAACACCCCTGAACCGGGAGAGTGACTGCTTTCTGCATATCATGCAGCAGCATCCAGCTATGATCCAGCAGATGCTGTCCACGGTGCTGAACATCATTATCTTTGAAGATTGTAGGAATCAGTGGTCTATGTCTCGACCCCTGCTTGGCTTAATACTGCTTAATGAAAAGTATTTTTCTGACCTAAGAAACAGCATCGTCAATAGCCAACCACCAGAGAAACAGCAGGCCATGCATCTGTGTTTTGAAAATTTGATGGAAGGCATTGAACGGAATCTTCTGACGAAAAACAGAGACAGGTTCACCCAGAACCTGTCAGCATTCCGTCGAGAGGTCAACGACTCAATGAAGAATTCCACTTATGGAGTGAATAGCAATGACATGATGAGCTGACAACTCTCGGACTCTACCTTGCAGAGCAGCGTCCCTTTGGTCTGGTCCAGAGGGTGAACAGTTGCAAGGGAGAGAGCCTGGCTGATCCCGGCTCCTTCCTCCAGGGGTATGGGGGAAATGGCAAAAGTCAACCAGCTATTTCCCCAGAAAGTACGGGGAAGTACGGGGTGTGCGTGCACTCACTGAGGGACAGGGCACTGCTGGTTCCTGGGGGACTGGGGTGGGAAGGGGTGGTGGGAGGAGACAGACGCACAGGCATCTGAGCCTCCGGCCGCTCCTGGGGTCACCGTGCAGGGAGAGCCCGGCGCCCTGCCGCAGCCTGCCTTGTATAAACATGTACATTTTTTCATAACGTTTTCAACAAGGTTTATATTGACTCAAGTTTAAAAACAAAAGTGTGACTGAAAACTTTTTACAGAGTCTAGTGCACCAATGCTGACGTGAGGGGTGATGTATGGCGAGTGAAGAAAATGTGCATTGTGGTGGCCTGAAGCTTTATTGGACAAGGATGTGTGAAAGTGCAGAGATATATTTAGTGACACAGTGTAGAGAGGCAAAAAAGGAAAAAACTCCAAATGTATATTTTTTCTTACTGCCCTTTCCCTCCCCACCCCCACTGATGCGTTCCTGATGCTGTATTAACCTTGTTATTAGGAACTCTGAGCCATGCGGGAGCACCACCCTCCCCATCCATGGATGCTGCCCTGGGCCCCCCAGCCTCCTGCAGTGACAGATAACTCCAGCTAAAGTCTCTGGTGTTCTTATCTCCATCCTTTCTCCCATTTTACTTAACCCTCATCCTCAGAAAGATGCCTCTTGCTATTAAAAGTCGGATTTATGTTTTAGGATTCTTGGTCTCTATAGGGAGACGACAGAGAATTGAGCCATTTGCTCTCTTGTTGAGCAATTTGCATGAGTCCACCAGAGGCCTAATATGTGTGGCCATAACTTTTGTCTTCCCCAGCCTTTGAGGCAGTGTGTGTGGATGTGTGTGGATATTTATGTGTGTACCCTGCACTCATGAATGTATGAACTGGAGGAAGTTACTACAGGGGAGGGCTCTCAATAACAAGGTCTACCTAGCATGAAGTATTTAACATTCTCCCTTGAAAAATATACATTTTTATAAAATAAAAACCATAATAAATGTTTTGAATATTAAAAAAGAAAAGTGAACCTACAGAGGAACATTGGATGGAGAAAACTCTTTGCCTTGTACTTTCCCACAACTGCTGCTAGTTATATACATCTCTAGTACAGCTCTTACCCATGGGACATTACCAATTAGGTTTTATTTTTATTTTCCTCAATCCTCACAAACAAGCTTATTAATTTTCCTTCTCCTCTGGCGACTGTGTGGTGAATCTTTTCTTGCGTGATCAGGTTGCGGATAGACTTGTAAGGGTGTTTGCTGCATACAGTGTAAGCATTGTGA