Transcript asmbl_15952

Sequence
Transcript Sequence for observation asmbl_15952 of TGE0032140:
CCACTGGGTCTGACCCTGGAACTCCAGGGCTATCTTTGACTGGTTCCATATCATCGTTATCCGCACCCGGACTTCCATCCAGGCACGCACTCCAACGTGGCAAGAATCAAAGTTCTCAAACTATAGATCTGGCGATCTGGGCAGAAAGAAACCCAGAGGCTGCGTCTGCTGCTGATATCCCCTTTGATGTGAGTCATGGTAGCGCCTATGAAGGGCCAAGTGTGTGTGGTAACTGGTGCCTCCAGGGGTATTGGCCGTGGCATTGCCTTACAGCTTTGCAAAGCAGGTGCCACAGTTTACATTACCGGCCGCCATCTGGATACGCTTAGAGCTACTGCCCAGGAGGCACAGTCCCTCGGGGGCCGGTGTGTACCCGTGGTGTGTGATTCAAGCCAGGAGAGTGAAGTGAAAAGCCTGTTCGAGCAAGTAGATCGGGAACAGAAAGGGCGGCTAGATGTTCTGGTCAATAATGCCTATGCTGGCGTCCAGGCAATCCTGAACACCACCAACAAGTCTTTCTGGGAAGTGCCTGCCTCCATTTGGGATGACATAAACAATGTTGGACTCAGAGGCCACTACTTATGCTCTGTGTATGGGGCACGGCTGATGGTGCCAGCTGGCAAAGGACTCATCGTGATTGTCTCCTCCCCTGGGGGGCTGCAGCATATGTTCAATGTCCCTTATGGTGTGGGCAAAGCTGCGTGTGACAGACTGGCTGCTGACTGTGCCCATGAGCTACGGCGTCACGGAGTCAGCTACGTGTCTCTGTGGCCAGGGCTGGTGCAAACAGAAATGGTGAAGGAGTTTATGGCAAAAGAGGATACTCCTGAGGACCCTCTATTTAAGAAGATGAAACCAGATTTCTCATCAGCCGAAAGTCCAGAAATGAGTGGCAAGTGTGTGGTGGCCTTGGCAACAGACCCCAATATCCTGAACTTGAGCGGGAAGGTGCTGCCGTCCTGTGACCTTGCTCGGCGCTATGGCCTTAAGGATATCGATGGTAAGTGTTTGCCCTGGGCCAGCTTTAACCAATGACTGTGTGCCCTGCTCCTTTCTCCCAACTTTTCAGCCAGAGTTGGGGTGTCCAAGAAGAACGAAATAAGGGTCTACCTTCCCT