Transcript asmbl_15936

Sequence
Transcript Sequence for observation asmbl_15936 of TGE0032135:
CGGCCCTGTAGCAGCGGCGGCGTCGGCGGCGGCTCGGCAGCTGCCATGGAGCCTGCGGGTTTGGAACAGATCCTGAAGGAGCTGCTGCTGCCCGACACGGAGCGCATCCGCCGGGCTACGGAGCAGCTCCAGACCATCCTTCGGGACCCTGCTGCCTTGCCCGCACTCTTCGATCTGCTGGCAACAGCGACCGACTCTCAGATCCGCCAGTTTGCAGCGGTCCTGACCCGCAGAAGGCTGAACAATCGCTGGCGACGCCTGGCACCTGAGCAGAGGGAGAGCCTCAAGTCCCTGGTCCTGACAGCACTGCAGAAAGAGACAGTGCATTCTGTGAGTGTCAGCTTGGCCCAGCTCTCAGCCACCATTTTTCGAAAGGAAGGCCTACAAGGATGGCCTCAGTTCATGAACCTTCTTCAGCACAGCACTCATAGTTCCCATAGCCCCGAGAAAGAGGTGGGACTTCTGCTGCTGAGTGTGGTGGTGTCTTCCCAGCCCGAGGCATTCCATGCCCACCAGCACGAGCTGCTTCAGCTTCTGAATGAGACGCTCAGTGACGTCAGCTTTCCCGGAGTGCTCTTCTACTCCCTGCGCACTCTGACTGCCATCGCCCGCTATGTCAGGCCGGATGATGTGTCTCTTGCACGGATGTTGGTGCCCAAAGTCGTTACGGCACTGAGGACTCTGATCCCCTTAGATGAGGTAAAGGCCTGTGAGGCCCTGGAGGCCCTGGATGAAATGCTGGAGACAGAGTTGCCCATCATCAACCCCCACCTCTCTGAGGTCCTCACGTTTTGCCTGGAGGTGGCTAAGAATGTGGCCCTTGGCGAACCACTCCGCGTACGTGTTCTCTGCTGCCTCACTTTCTTGGTCAAAGTCAAAAGTAAGGCCTTACTAAAGAACCGCCTCGTGCCTCCCTTGCTGCACGCCCTTTTCCCCCTCATGGCTGCTGAGCCACCCATGGGCCAACTGGATCCTGAAGATCAAGATTCGGATGACGATGACTTGGAGATCGGGCTGATGGGGGAGACTCCCAAGCACTTTGCTGTACAGGTTGTGGACATGCTGGCACTACATCTTCCCCCTGAGAAGCTCTGTCCCCATGTGATGCCCATGCTGGAAGAAGCCTTGCGGAGCGAGGACCCATACCAGCGCAAAGCAGGATTCCTGGTGTTGGCTGTGCTGTCTGATGGTGCAGGCGACCACATCAGGCAGAGACTGCTGTACCCACTGCTACAGATTGTGTGCAAGGGCCTGGATGACCCCTCACAGATTGTTCGTAATGCTGCTCTGTTCGCCCTGGGCCAGTTTTCAGAGAACTTACAGCCCCATATCAGCAGCTACTCTGAGGAGGTGATGCCCCTTCTCCTCTCCTACCTGAAGTCAGTGCCGATGGGAAACACACACCACCTGGCCAAGGCCTGCTATGCTCTGGAGAATTTTGTGGAGAACCTAGGGCCCAAAGTGCAGCCCTACCTTCCGGAGCTTATGGAATGTATGCTGCAGCCATTGAAGAACCCCAGCAAAGCCCGGACCAAGGAGCTAGCTGTGAGCGCCATAGGGGCCATTGCCACAGCGGCCCAGGATTCCCTGCTGCCCTACTTCCCTACCATCATGGATCTTCTCCGGGAGTTCTTGTTGACAGGCCACGAAGACTTTCATCTTGTGCAGATCCAGAGCCTGGAGACCCTGGGAGTGCTAGCACGAGCCCTGGGAGAGTCCATGAAGCCCCTGGCTGAGGAATGCTGTCAGCTTGGGCTAGGGTTATGCATCCATATAGATGACCCTGACGTGAGGCGCTGCACGTACAGCCTGTTTGCAGCCTTATCAGGGTTAATGGGAGAGGGCTTGGGACCCTACCTGCCTCAGATTACCACGCTCATGCTGCTGTCGCTGCGCTCCACTGAGGGCATTGTGCCACAGTATGACGGGATCAGCTCCTTCCTGCTGTTTGATGACGACAGCGAAGCAGAAGAGGAGGAGGAGCTCATGGATGAAGATATGGAAGAGGAGGGGGATGACTCTGAGATCTCGGGGTATAGTGTGGAGAATGCCTTCTTTGATGAGAAAGAAGACACCTGCACCGCCCTGGGGGAGATCTCCATGAACACCTGTGTGGCTTTTCTCCCATTCATGGATGCCACCTTCGATGAAGTATACAAACTGCTGGAGTGCCCTCATATGAATGTGCGGAAGTCAGCTTACGAAGCGCTGGGACAGTTCTGCTGTGCACTGCATAAGGCCTCTCAGAGAAGCTCCTCAGATCCCAGCAGCAGTCCCGGTGAGGAGGAGACGTAGCAGGCTGGGAGCCCTGGGGAGTGGCCGGGCCTGACCAAGGCTCCCACCAATTGTGTCTCCAGTTCTGCAGACCTCCCTGGCTCGAGTGATGCCAGCTTACATGCAGGCCGTGAAAGTAGAAAGGGAGCGCCCAGTGGTGATGGCCGTGCTGGAGTCCCTGACAGGGGTGCTGCGCACCTGCGGCAGCCTTGCACTGCAGCCTCCTGGGCGGCTCAGTGAGCTCTGCAACGTGCTCAAGGCTGTGCTGCAGAAAAAGACGGCCTGTCAGGACGCCGAGGAGGATGATGACGAAGATGATGACCAGGCAGAGTATGACGCCATGTTACTAGAACATGCTGGAGAGGCCATTCCCGTCCTGGCAGCCACAGCTGGAGGACACGCCTTCGCTCCCTTCTTTGCCACGTTCTTGCCATTGTTGCTGTGTAAGACGAAACAGAGCTGTACAGTGGCAGAGAAGTCCTTTGCTGTGGGAACCCTGGCAGAGTCCATTCAGGGTCTAGGGACCGCCTCAGCCCAGTTTGTGTCTCGGCTGTTCCCTGTGCTGTTAAACAATGCCCGGGAAGCAGACCCTGAGGTGCGGAGCAATGCCATCTTTGGGTTGGGCGTACTGGCAGAGCATGGCGGCTGCCCTGCTCAGGACCACTTCCCTAAGCTACTGGGCCTCCTTTTGCCCCTGCTGGCAAGGGAGCGACATGATCGAGTCCGTGATAACATCTGCGGGGCTCTTGCCCGTGTACTGATGGCCAGTCCAGTAGGAAAAACGGAGCCCCAGGTGCTGGCTACCCTGCTACGTGCCCTGC