Transcript asmbl_15921

Sequence
Transcript Sequence for observation asmbl_15921 of TGE0032127:
GGGTAAGTGGCAAGATGGCTCCCCTGCATGTCTCCGGCTGATCGCTGCCGCTTTACCAATACAATAGAGTCTGCTTACTACCAGCAACCTGGCCCTCTTCCTCCTCTTCCTCCAGAGAGACCAGTCCAGCCGAACTCGGGGTTTGCCTGAAGAGAAGGAGGAAGTGACCATGGACACCAGTGAAAACAGACCTGAAAATGAGGTGCCTGAGCCTCCTCTGCCTGTTGCAGACCAAGTCAGCAATGATGAGCGCCCAGAGGGTGGTGCTGAAGAAGAGGAAAAGAAAGAGAGTTCGATGCCCAAGTCATTCAAGAGGAAAATCTCCGTTGTCTCAGCTACCAAGGGGGTGCAAGCTGGAAACAGTGACACAGAGGGGGGCCAGCCTGGCCGAAAACGCCGTTGGGGAGCCAGCACTGCCGCGACACAGAAGAAACCGTCCATCAGTATCACCACTGAGTCACTCAAGGAGGCTGTTGTGGATCTTCATGCCGATGACTCCCGAATCTCTGAGGATGAGACAGAGCGTAATGGCGACGATGGGACCCATGACAAGGGACTGAAGATATGCCGGACAGTCACTCAGGTAGTACCCGCAGAGGGCCAGGAGAATGGGCAGAGGGAAGAGGAAGAAGAGAAAGAGCCTGAAGCCGAGCTGCCGGCGCCACCCCAGGTGTCAGTGGAGGTTGCCTTGCCCCCACCTGTGGAGCACGAAGTAAAGAAAGTAACATTAGGAGATACCTTAACCCGGAGGTCCATCAGCCAACAGAAGTCTGGAGTTTCCATTACAATTGATGACCCAGTCCGGACCGCCCAGGTGCCCTCCCCACCCAGGGGCAAGATCAGTAACATTGTCCACATCTCCAACCTGGTTCGTCCCTTCACTTTAGGCCAGCTGAAGGAATTATTGGGGCGTACAGGAACTTTGGTGGAAGAGGCCTTCTGGATAGACAAGATCAAATCTCATTGCTTTGTGACGTACTCTACAGTAGAGGAAGCCGTTGCCACCCGCACAGCTCTGCACGGGGTCAAGTGGCCCCAGTCCAACCCCAAATTCCTTTGTGCTGACTATGCTGAGCAAGATGAGCTGGACTATCACCGGGGACTCTTGGTAGATCGGCCATCTGAAACTAAGGCAGAGGAACAGGGAGCACCAAGGCCCCTGCATCCCCCACCCCCACCCCCAGTCCAGCCACCGCCCCACCCCCGGGCTGAGCAGCGGGAGCAGGAAAGGGCTGTTCGAGAGCAATGGGCAGAACGGGAACGGGAAATGGAGCGCCGGGAGAGGACTCGGTCTGAGAGAGAATGGGATCGGGACAAAGTTCGAGAGGGACCCCGCTCCCGATCACGGTCCCGTGACCGCCGCCGGAAAGAGCGAGCAAAATCTAAAGAAAAGAAGAGTGAAAAGAAAGAAAAAGCCCAGGAGGAGCCACCTGCCAAGCTGCTGGATGACCTCTTCCGTAAGACTAAGGCAGCTCCCTGCATCTATTGGCTCCCTCTGACTGAGAGCCAAATTGTTCAGAAGGAGGCAGAGCAAGCTGAACGGGCCAAGGAGCGGGAGAAGCGGCGAAAAGAACGAGAAGAAGAAGAACAAAAGGAACGGGAGAAGGAAGCTGAGCGGGAACGGAACCGGCAGCTAGAACGGGAGAAGAGGAGGGAGCACAGCAGGGAGAGAGAGAGGGACAGGGAGAGAGAGCGGGACAGGGGTGACCGAGAGCGGGAGAGGGAGCGAGACCGAGACCGAGGCAGGGAGAGGGATCGCAGAGACACCAAGCGCCACAGCAGAAGCCGGAGTCGAAGCACACCTGTACGGGACCGGGGTGGGCGCCGCTAGCCAAGAAAACACTAGAGAGCTGCAGGTACCTGCCACTTGGTCCTGGGAGGTCAAAGGCCACAGAGGGATAGGTACAGTCACCACCACCCTGGAACCAAGGGTCTCACACCATTGCTCAGTGCTGAACTATAACTGCCACACGTCCCCTCATATCAAATGGAGCAGTGGCAATCTCCCTGTTCCCCAACCTAACTCTTGGAACTTGGCCCTCTCCTTTCTTCCTGTTAAGTCTGAGAGGGAAGAGCTAGGCTATGAAGGGAAGATGTGGCCGTACGTGGGAATAACCAGTGTCCCACGCTCATTTTCCCTCCATCCTGCGTTCCGCCTCCCTTGGTACTCAGCCTTTTGGGGACAGCTGGGGCCAGGACTGGGTCACCTATGAGCTGAATCAGCCTCTCCTGAGTCCCAGGCCCCTGCAGTCCCCTGTTCTCTGGCCTGCAGTCTCTTGCCCGCTGGTTCCACTTTATAGCCACCTTTTCCTTTTGTTCAATTTTTATTTTTATTTTTTTTATTATTAAATGATGTGGTCTATGGAAAAATAAA