Transcript asmbl_15875

Sequence
Transcript Sequence for observation asmbl_15875 of TGE0032118:
GGTTCTGGGTTGTTCGTGGTAGTGCCGGTTACAGCTCGTCACTCGGCCTCACGACCGGGAGCCGTGAGGCACCATGCCCGCGGTGCTGGGGTTCGAAGGCAGCGCCAACAAGATCGGCGTGGGCGTGGTCCGCGACGGCACGGTGCTGGCGAACCCGCGGCGCACTTACGTCACGGCCCCGGGCACCGGATTCCTTCCAGGTGACACGGCCAGGCACCATCGAGCTGTTATCCTAGACCTACTGCAGGAGGCGCTAACAGAGGCAGGATTGACCTCCAAGGACATTGATTGTATTGCTTTCACCAAAGGTCCTGGCATGGGATCCCCATTGGCTTCTGTAGCTGTTGTTGCCCGTACAGTGGCCCAGTTGTGGAATAAGCCTTTGCTTGGCGTGAACCACTGCATAGGCCACATTGAAATGGGCCGTCTCATCACTGGAGCCGTTAACCCAACTGTCCTGTATGTGAGCGGAGGAAATACCCAGGTGATTTCCTACTCAGAACATCGTTATCGCATCTTTGGAGAAACTATTGATATCGCCGTGGGAAACTGCCTGGATCGTTTTGCTCGGGTGCTGAAGATTTCCAATGACCCCAGTCCAGGCTACAACATTGAGCAGATGGCAAAGCGGTAAGAGGATGTGAAGGCGAAGAGCCCTG