Transcript asmbl_15678

Sequence
Transcript Sequence for observation asmbl_15678 of TGE0032087:
CTTCCATCAAGTGGTGGCCTGGGGACTTGGGACGGACAGTCACCCATGCTGTGGTCCTAGCCCATTTGATCTGCTTAGGAGCCCGGCATGGCATGCATGCCTTCATTGTGCCCATCCGGAGCCTAGAGGACCACACCCCACTGCCAGGAATAACAGTTGGGGACATAGGCCCCAAGATGGGCTTCGAAAACATAGACAATGGCTTCCTGCGACTGAACCACGTGAGGGTTCCCAGAGAGAACATGCTCAGTCGCTTTGCAGAGGTCTTGCCAGATGGCACCTACCAGAGGCTTGGGACACCACAGAGCAATTATCTTGGCATGTTGGTGACACGGGTGCAGCTGCTGTATAAAGGATTCCTACCCACCCTCCAGAAGGCTTGCACCATTGCTGTGCGCTACGCAGTAATCCGCCACCAGTCTCGTCTTCGGCCTAGTGACCCAGAGGCAAAAATCCTGGAATACCAGACACAGCAGCAGAAACTCCTGCCTCAGCTTGCTGTGAGCTATGCCTTGCATTTCATGACCACCAGCCTCTTACAATTCTTCCACAGCTCCTACAGTGATATTCTGAAGAGAGACTTCAGCCTCCTGCCTGAGCTCCATGCACTGAGCACTGGCATGAAGGCCATGTCTTCAGACTTCTGTGCCCAGGGAACAGAGATCTGCCGCAGGGCCTGCGGGGGTCATGGCTACTCAAAGCTGAGCGGCCTACCGACACTGGTCACTCAAGCGATAGCCTCTTGCACGTATGAGGGTGAGAATACGGTGCTCTACCTGCAAGTGGCCAGGTTTCTGATGAAGAGCTACCTGCAGGCTCAAGTGTCCCCAGGATCCATACCACAGAAGCCTCTCCCTCAGTCCGTCATGTATCTCGCCACACCAAGACCAGCCAGGTGCCCAGCCCAGACAGCAGCTGACTTCCGCTGCCCAGAAGTCTATACCACAGCCTGGGCATATGTGTCTGCCAGGCTCACTGCTACTTCCTCACTGTGAGGAATTTCAAGGAAGCTGTGGAGAAACTAGACAACGAACCAGAGATTCAGCGTGTGCTTCAGAACCTCTGTGACCTCTATGCCTTAAACGGTATTCTGACTAACTCAGGGGACTTTCTGCATGATGGCTTCCTGTCTGGGGCCCAAGTGGACATGGCAAGAACAGCCTTCCTAGACCTGCTTCCCTTGATCCGGAAGGACGCCATCTTGTTAACAGATGCTTTTGACTTCTCGGACCATTGTTTAAACTCTGCACTTGGCTGTTATGACGGACACGTCTACCAACGCCTGTTTGAGTGGGCTCAGAAGTCCCCAGCCAATACTCAGGAGAACCCTGCCTATAAGAAGTATATTAGACCACTGATGCAAAGCTGGAAACCCAAGCTGTGAAAAGCCAAAGGATTCAGGACCAAGC