Transcript asmbl_15676

Sequence
Transcript Sequence for observation asmbl_15676 of TGE0032086:
CTTCCATCAAGTGGTGGCCTGGGGACTTGGGACGGACAGTCACCCATGCTGTGGTCCTAGCCCATTTGATCTGCTTAGGAGCCCGGCATGGCATGCATGCCTTCATTGTGCCCATCCGGAGCCTAGAGGACCACACCCCACTGCCAGGAATAACAGTTGGGGACATAGGCCCCAAGATGGGCTTCGAAAACATAGACAATGGCTTCCTGCGACTGAACCACGTGAGGGTTCCCAGAGAGAACATGCTCAGTCGCTTTGCAGAGGTCTTGCCAGATGGCACCTACCAGAGGCTTGGGACACCACAGAGCAATTATCTTGGCATGTTGGTGACACGGGTGCAGCTGCTGTATAAAGGATTCCTACCCACCCTCCAGAAGGCTTGCACCATTGCTGTGCGCTACGCAGTAATCCGCCACCAGTCTCGTCTTCGGCCTAGTGACCCAGAGGCAAAAATCCTGGAATACCAGACACAGCAGCAGAAACTCCTGCCTCAGCTTGCTGTGAGCTATGCCTTGCATTTCATGACCACCAGCCTCTTACAATTCTTCCACAGCTCCTACAGTGATATTCTGAAGAGAGACTTCAGCCTCCTGCCTGAGCTCCATGCACTGAGCACTGGCATGAAGGCCATGTCTTCAGACTTCTGTGCCCAGGGAACAGAGATCTGCCGCAGGGCCTGCGGGGGTCATGGCTACTCAAAGCTGAGCGGCCTACCGACACTGGTCACTCAAGCGATAGCCTCTTGCACGTATGAGGGTGAGAATACGGTGCTCTACCTGCAAGTGGCCAGGTTTCTGATGAAGAGCTACCTGCAGGCTCAAGTGTCCCCAGGATCCATACCACAGAAGCCTCTCCCTCAGTCCGTCATGTATCTCGCCACACCAAGACCAGCCAGGTGCCCAGCCCAGACAGCAGCTGACTTCCGCTGCCCAGAAGTCTATACCACAGCCTGGGCATATGTGTCTGCCAGGCTCATAAGAGATGCAACACAGCATACACAGACCCTCATGAGATCCGGGGTTGACCAGTACGATGCTTGGAACCAGACTTCTGTCATACACCTTCAGGCTGCTAAGGCTCACTGCTACTTCCTCACTGTGAGGAATTTCAAGGAAGCTGTGGAGAAACTAGACAACGAACCAGAGATTCAGCGTGTGCTTCAGAACCTCTGTGACCTCTATGCCTTAAACGGTATTCTGACTAACTCAGGGGACTTTCTGCATGATGGCTTCCTGTCTGGGGCCCAAGTGGACATGGCAAGAACAGCCTTCCTAGACCTGCTTCCCTTGATCCGGAAGGACGCCATCTTGTTAACAGATGCTTTTGACTTCTCGGACCATTGTTTAAACTCTGCACTTGGCTGTTATGACGGACACGTCTACCAACGCCTGTTTGAGTGGGCTCAGAAGTCCCCAGCCAATACTCAGGAGAACCCTGCCTATAAGAAGTATATTAGACCACTGATGCAAAGCTGGAAACCCAAGCTGTGAAAAGCCAAAGGATTCAGGACCAAGCAGCACCATGGCCTTCCTATGGCACATATGCATATAAAGAATTTAAAGCACGGGGTGGCGTGCGGCTTGTTCAGATCAGCGAGTAAACTGGTACATGAAAGGATGTTCATCATATTATTCTGCTACTGAGTACATCTGAAACTTTCCCTTGTCTGTTTGTAGTACGTATTTGGCTAAATGCTAGAATTTTGCTTTAAATACAGCAAAAGCTAATAAACTTGTTAGTAAC