Transcript asmbl_14780

Sequence
Transcript Sequence for observation asmbl_14780 of TGE0032074:
GGCGGAAGCCCCAACCTTCTTCCCTGGCGAGTTAGAAGCTGCCCCTCACCGAGGAGGAGAATGGCGCTCAAACAGATTTCCAGCAACAGGTGCTTTGGCGGGCTCCAGAAAGTTTTCGAACATAGCAGTGTTGAGCTGAAATGTAAAATGAGATTTGCTGTCTACCTACCACCCCAGGCCGAGAGTGGAAAGTGTCCAGCGCTTTACTGGCTGTCTGGTTTAACTTGCACAGAACAAAATTTCATATCAAAGTCTGGCTATCAGCAAGCTGCCTCAGAGCACGGCCTTGTGGTCATTGCCCCTGATACCAGCCCTCGTGGCTGCAATATCAAAGGAGAAGATGACAGCTGGGACTTCGGCACTGGTGCTGGGTTTTATGTGAATGCCACTGAAGATCCTTGGAAAGCTAACTACAGAATGTACTCTTACGTCACCGAGGAGCTTCCACAACTCATAAATGCCAATTTCCCAGTGGACCCACAGAGGATGTCTATTTTTGGTCACTCCATGGGAGGCCACGGAGCTCTGATTTGTGCTTTGAAAAATCCTGGAAAATACAGATCTGTGTCAGCATTTGCTCCAATTTGCAACCCTGTGCTGTGTTCTTGGGGCAAAAAAGCTTTTAGTGGATATTTGGGACCAGATGAAAGTAAATGGAAGGCATACGATGCGACCTGTCTCGTGAAGGCCTATTCGGGTTCCCAGATTGACATCCTAATCGATCAAGGAAAAGATGACGAGTTTCTTTCAAATGGGCAGTTACTCCCTGATAACTTCATAGCTGCCTGCACAGAGAAGAAAATCCCTGTTGTGTTTAGACTACAAGAGGGTTATGATCATAGCTACTACTTCATTGCAACTTTCATCGCTGACCACATCAGACACCATGCTAAGTACCTGAATGCATGAAAAGCCTCAGCCAAGAGAATCTCATCAGGAGGCCGGAAGGGAATCAACAGGAGTGCTGACTTCCTCGCAGAAGATCATGCTCCTGCAGCTGAATCGCTTTTCTGAATAAATATATCAAACTTT