Transcript asmbl_14779

Sequence
Transcript Sequence for observation asmbl_14779 of TGE0032073:
GCGGTGCCCAGGGGACGGGTCGGACTCAGAAATGGCGGCGTCCATGTTCTACGGCCGGCAGTTGGCCGCGGCCGCCCTGAGGAGCCACCGGCCGCAGACTACGCTGCGAGCCGCCGCCCAGGTTCTGGGAAATTCTGGCTTGTTTAACAAGCATGGACTACAAGTGCAGCAGCAGCAGCAGAGGACCCTTTCGCTGCATGAATACTTGAGTATGGAGTTATTGCAGGAAGCGGGTGTCTCTGTTCCCAAAGGCTTCGTGGCAAAGTCATCCGATGAAGCTTACGCAATTGCCAAAAAATTAGGATCAAAGGATGTTGTGATAAAGGCACAGGTTTTGGCTGGCGGCAGAGGAAAAGGAACATTTACAAGTGGCCTCAAAGGAGGAGTGAAGATTGTTTTCTCTCCAGAAGAAGCAAAAGCTGTTTCCTCACAGATGATTGGGCAAAAATTGATTACCAAGCAAACTGGAGAAAAGGGCAGAATATGCAATCAAGTTTTGGTCTGTGAGCGCAAATATCCCAGGAGAGAATACTACTTTGCAATAACAATGGAGAGGTCATTTCAAGGTCCTGTACTGATAGGAAGTGCACAAGGTGGTGTTAACATTGAAGATGTGGCTGCCGAGAACCCTGAAGCCATTGTAAAGGAGCCTATTGATATAGTGGAGGGCATCAAAAAGGAACAAGCCGTGACACTTGCACAGAAGATGGGATTTCCTTCTAACATTGTGGACTCTGCAGCAGAAAACATGATCAAGCTTTATAATCTTTTTCTGAAGTATGATGCAACTATGGTAGAAATAAACCCAATGGTAGAAGATTCTGACGGAAAGGTGTTGTGCATGGATGCAAAGATCAATTTTGATTCAAATTCAGCCTACCGCCAGAAGAAGATCTTTGATCTTCAGGACTGGAGTCAGGAAGACGAAAGGGACAAAGAAGCAGCTAATGCAGATATTAACTACATCGGCCTCGATGGGAGCATAGGATGTCTAGTAAATGGTGCTGGCTTGGCTATGGCCACAATGGATATAATAAAACTACACGGAGGGACTCCAGCCAACTTTCTTGATGTTGGTGGAGGCGCCACAGTCCAGCAAGTAACAGAAGCGTTTAAACTCATCACTTCAGATAAAAAGGTGCAGGCTATTCTGGTCAACATTTTTGGAGGAATCATGAGATGTGATGTTATTGCACAAGGAATAGTCATGGCAGTAAAGGATTTAGAAATCAGAATACCTGTTGTGGTGCGGTTACAAGGTACACGAGTTGATGATGCTAAGGCACTAATAGCAGACAGTGGTCTTAAAATCCTTGCTTGTGATGATTTGGATGAAGCTGCTAAAATGGTTGTAAAGCTCTCTGAAATAGTGACCTTAGCCAAAGAAGCCCATGTGGATGTGAAGTTTCAATTGCCAATATGAGCAAGACCTTGGTGGATGGCTACGGGTATTAATGTGCTGTAATTCTTTATTATACTGTGGTCTCTCCTAGTGTCCCTTTTCTTTTAATGTGTGGAGAATGTAATCACCACATAGGCACACATACCTTTGAAAGCATTTGCTCTGCATCTGATTCTGCTGCTGAGAATGGACTGTTTATATAAAGAATGTCTGATATAAACTTACGGTGGTCTCTTTTCTTGCAGCCATCTTTTTTTGCTTCCTCTACAGAATGTCACTTGCAGTATGCCTGCTTTCTGGTGTTGGATACAGAG