Transcript asmbl_14688

Sequence
Transcript Sequence for observation asmbl_14688 of TGE0032069:
ACCTGAGCGCCTGCTTTCTGAAGGACATTGCTGTATTTATCACCGACAAGATCTCCAGCTTTTGTCTTCAGGTGGCCTTACAAGTCCTCCACCAAAAATTACCTCAGCACTGTGCCCACCTCTGCGATGCAGTCATTGATTACCTGAGTTCTCGGAATTCTTCAGCAGATGGCAGCCCTCTACTCCTGTTTCTTCGGGATCAGACGAGCTCTAGACTCTTGGAGCAGGTGCTGCTGGTATTAGAAGCAGAGAGACTCCAGCGCCTCTATAAGGACCACTTCCAGGGTCAGCTATGCTCCTTGGCTGAGCATCCCATTGCGAACTTCCCTTTGCAGCGCTTGCTGGATGCAATCACTTCCCCTGAGCTGCTGTCCCTTGTGTTTGAGGAGCTGAGCCCTGCCTTGGAAATGGTGCTGGCCCAGGGCCACCCAGGGGTCGTCGTCGCCCTGGTGGAAGCCTGCCGCAGGGTTGGGACTCACCAAGCCCAGGTCTTGCAGCTGTTATTTGAGGCATTTCATTGTGCAGAGCCCCCGTCCCGGCAAGCAGCCTGCGTGCCTCTCTTTGCTGCTTTGTTGGCTTATGAGGTATACTATGAACTAATGGAGGAGGAGGGGGCTGTGCCTGCAGAGCATCAGGTTGAAATGGCCACAGCCAGAGCGCTGAGGGAGGTGACTGTACTTGGGTCTCTACTGCTCCAGCATTTGCTGTATTTTTCTAATCCTGGACTTGTACTTCGAAGTCTGAGTGCCTTGACCGGACCACAGCTTCTGACTCTGGCCCAAAGCCCCGCTGGCTCTCATGTATTTGATGCCATCCTGAGTAGCCCCTCAGTGACACACAAGCAGCGTCGTCGTGTGCTGAAGACCCTAAAGGGACAGTATGTGGCTCTTGCCTGTAGCCGCCATGGCAGCCGTGTATTAGATGCCATCTGGAGTGGAGCAGCTTTGGGGGCTCGGAAGGAAATTGCTGCTGAATTGGGAGAAAAGAACCAGGAGTTGATTCAAGATCCTTTTGGCCACCATGTGGCTCGAAATGTGGCCCTTACTACCTTCTTGAAGAGGCGAGAGGCTTGGGAACAACAGCAAAGTACTGTGGCCAAGCGGAGGCGGGCATTGAGCTCTATACTTGAAGACTGAGACTTGCAACGGGACTCGGTCTTGATGGGGAGGGGAACATGCTTACCCTTCCTGTTTACATTGGATCCAAAAGTCTTACTGCAGCCAGATGTAGTAACATGCACAAAACTGTAAACCTACTATTCCAGAGGGTAAAACAAGAATATCAAGAATTCAAGGCTAGCCTGCTCTGTGGCAGCTAGATCTTGTTAATCTCTATGTCCATCTGCTATTCTCTCCCCTCTCCCAAGACATACTGGTAAAGACTTTTGTATTTTTCTTGGAAA