Transcript asmbl_14605

Sequence
Transcript Sequence for observation asmbl_14605 of TGE0032055:
GACCTTCGGGAGAAAAACTGGGAAGCAATGGAAGCTTTGGCATCAACTGAAAAAATGCTGCAGGACAGAGTGAACAAGACTTCCAAGGAAAGACGGCAACACGTGGAAGCTATTGAGTTAGAGTCCAAAGACCTTCTGAAGAGGTTATTTCCAACGGTGTCTGTCCCTTCTAATTTGAATTACAGTGAATGGTTGCGTGGCTTTGAAAAGAAGGCAAAAGCGTGCGTAGCTGGAACTTCAGACGCAGAGGCGGTCAAGGTTTTGGAGCACAGATTGAAAGAAGCTAGTGAGATGCACACTTTGCTACAGCTGGAATGTGAAAAATACAAGTCGGTCCTTGCAGAAACAGAAGGGATTTTGCAAAAACTTCAGCGAAGTGTGGAGCAAGAAGAAAGTAAATGGAAAATTAAAGCTGACGAGTCTCAAAGGATGATTAAACAGCTGAGAAGAGAAAGAGAGCATTTGGAAATGGAGCTAGAGAAGGCCGAGATGGAGCGATCGACTTACGTGATGGAAGTCAGAGAGCTGAAAGATCTGTTGACTGAGTTGCAGAAAAAGCTTGATGATTCATATTCTGAAGCAGTAAGACAGAATGAAGAGCTTAACTTGCTCAAGACACAGTTAAATGAAACACACTCAAAACTTCAAAATGAACAAACGGAGAGAAAGAAGGTAGCTGATGATTTGCATAAGGCTCAACAGTCCCTGAACTCTATCCACTCAAAAATCTCACTGAAAGCTGCTGGAGACACTGTTGTTATTGAGAACAGTGATATTTCCCCAGAAATGAGTGAAGTAATTGGGAAATTACTCGTTAGAAGTTAACAGAAGGCGTTGTATTGTATTTTGCCAAATTAAAGCCTTATTTATGTTTTACCCTTTCTACTTTGTCAGACACTGGACAGTTTTGTCTTTTCTAATCCTTGTTAGACTACTGACTTAAAGAGAAACACTTTAAAAAGCCAACTCTGTAGACACCTTCAGAGTTTAGTTTTATAATAAAACTGTTTGAATAATTAGACCTTTACATTCCTAAAGATGAAGTAAATGTAAACTTTTACCTTATTTTGCTCAATTAAATTGTTCAGAAGATCAAAGTGGTATAGACAATGTGAAATTTAACATTTTAATACTGATGTTGTACACTGCTTTACTTAACATTTGGGAAGAAGCCGCCTCTGACATCAACTCAAGGAAACACTTTTTGTTGCTATTATAATCAGCAAATAAAGG