Transcript asmbl_14601

Sequence
Transcript Sequence for observation asmbl_14601 of TGE0032053:
GAAATGATGACAGAGAAAGAAAGAAGCAGTGTTGTTATAGCAAGAATGAAAGATCGGATTGGAACACTAGAAAAGGAACACAATATATTTCAAAACAAAATGCATGCCAGTTACCAAGAGACTCAGCAGATGCAGATGAAGTTTCAGCAAGTTCAGGAACAAATGGAAGCAGAGATAGCTCATTTGAAGCAGGAAAATGGTATCCTGAGAGATGCTGTCAGTAACACTACAAACCAACTGGAAAGCAAGCAATCCGCAGAGCTAAATAAACTGCGCCAAGACTGTGGGAGGCTGGTGAGTGAACTGAACGAGAAGACAGGAAAGCTGCAGCAAGAGGGAGTCCAGAAGAAGAATGCGGAGCAAGCTGCTACCCAGCTCAAGGTTCAACTGCAAGAAGCTGAGAGGCGCTGGGAAGAAGTTCAGAGCTACATCAGGAAGAGGACGGCGGAGCATGAGGCTGCCCAGCAAGATTTACAAAGTAAATTTGTGGCCAAAGAAAATGAAGTCCAGAGTCTACATAGTAAGCTCACAGACACCTTGGTATCAAAACAGCAATTGGAGCAAAGACTAATGCAGTTGATGGAATCCGAGCAAAAGAGGGCGAGCAAAGAAGAGTCTCTGCAGATCCAAGTGCAGGATATTTTGGAACAAAACGAGGCTTTGAAAGCTCAGATTCAACAATTCCATTCCCAGATAGCAGCTCAGACCTCCGCTTCAGTTCTAGCAGAAGAATTACATAAAGTGATTGCAGAAAAGGACAAGCAGCTAAAGCAGACTGAAGATTCATTAGCGAATGAACAGGATCACTTAGCAAGCAAGGAGGAGGAGCTTAAGGATGTACAGAATATGAATTTCTTATTAAAAGCTGAAGTGCAGAAATTGCAGGCCCTGGCTAATGAGCAGGCTGCTACCGCACATGAGGTGGAGAAGATGCAGAAGAGTATTCACGTAAAGGAAGATAAAATAAGACTGCTTGAGGAGCAGCTGCAGCACGAAGTTGCCAGCAAAATGGAAGAATTGAAGATTCTGAGTGAGCAGAATAAAGCATTACAGTCGGAAGTTCAGAAACTGCAGACCGCTGTTTCTCAGCAGCCTAATAAAGATGTTGTGGAACAAATGGAAAAATGCATTCAAGAAAAAGATGAGAAGTTAAGGACTGTGGAAGAATTACTGGAGACTGGACTCATTCAGGTGGCCACCAGAGAGGAGGAGCTGAGTGCCATAAGAACAGAGAACTCCACCCTGACCAGAGAAGTTCAAGAGTTGAAGGCTAAGCAGAGCGATCAGGTTTCTTTTGTGTCTCTAATTGAAGATCTTAAGAGAGTGATCCATGAGAAAGATGGACAGATCAAGTCTGTGGAAGAGCTTCTAGAAGTTGAACTTCTCAAAGTTGCAAATAAGGAGAAAACTGTCCAGGCTTTGAAACAGGAAATAGAGGTTCTAAAAGAAGAAATAGGAAATGCCCAGCTTGAAAAGGCTCACCAGCTGTCTGTCACTTCTCAAGTCCAGGAGCTGCAGAACTTATTAAGAGGCAAGGAAGAGCAGGTGAACAGCATGAAGGCTGCCTTAGAAGACAGGGACAGAGACCTGAGAGGGAGAGGGACGTGCGCACAGGTGTGTTCGACACCACAATTTGAAGAACTTGAAAGTGTGTTGAAAGAAAAGGACAATGAAATTAAGAGAATAGAAGTTAAATTAAAGGACACGGAGAGTGATGTTTCTAAGATGTCAGAGCTATTAAAGGCATCTTTTCCCTCTCAGGAAGAATTACAAACAGTAATTTCAGAAAAAGAGAAAGAAATAACTGATCTCTGCAATGAGTTAGAGTCTTTGAAGAATGCTGTTGAACACCAGAGGAAGAAAAACAATGTAA