Transcript asmbl_14583

Sequence
Transcript Sequence for observation asmbl_14583 of TGE0032050:
GGCTGCCATGGCCCTTCCCGGCATCCCCTATGAGCGACGGCTTCTCATCATGGCGGACCCTAGAGATAAGGCGCTTCAGGACTATCGCAAGAAGCTGCTAGAGCACAAGGAGATTGACGGCCGTCTTAAGGAGCTAAGGGAACAATTAAAAGAACTTACCAAGCAGTATGAAAAGTCTGAAAATGATTTGAAGGCACTACAAAGTGTTGGACAGATTGTAGGTGAAGTGCTAAAACAGTTAACAGAAGAAAAATTCATCGTTAAAGCAACAAATGGACCAAGATACGTTGTAGGTTGTCGTCGTCAGCTTGACAAAAGTAAGCTGAAGCCAGGAACCAGAGTTGCTTTGGATATGACCACACTAACCATCATGAGATATCTGCCAAGAGAGGTGGATCCATTGGTTTATAACATGTCTCACGAGGATCCTGGAAATGTATCTTATTCTGAGATTGGAGGCCTGTCAGAACAGATTCGGGAGTTAAGAGAGGTAATAGAATTGCCTCTTACAAATCCAGAATTATTCCAGCGTGTAGGAATAATACCTCCAAAAGGCTGTTTGCTCTATGGACCGCCAGGCACTGGGAAAACACTCTTGGCACGAGCTGTTGCCAGCCAGCTGGACTGCAACTTCCTAAAGGTTGTATCTAGTTCTATTGTAGACAAGTACATTGGTGAAAGTGCTCGTTTGATTAGAGAAATGTTTAATTATGCCAGGGACCACCAGCCATGCATCATTTTTATGGATGAAATAGATGCTATTGGTGGCCGTCGGTTTTCTGAGGGAACATCAGCTGACAGAGAGATTCAGAGAACTTTAATGGAGTTACTAAATCAAATGGATGGATTTGATACTCTGCATAGAGTTAAAATGATCATGGCTACAAACAGACCAGATACACTGGATCCTGCTTTGCTGCGCCCAGGAAGATTAGATAGAAAAATACATATCGATTTACCAAATGAACAAGCAAGATTAGATATATTGAAAATCCACGCAGGACCTATTACAAAGCATGGTGAAATAGATTATGAAGCAATTGTAAAGCTTTCAGATGGCTTTAATGGAGCAGACCTGAGAAATGTTTGTACTGAAGCAGGTATGTTTGCAATTCGTGCCGATCATGATTTTGTAGTTCAGGAAGACTTCATGAAAGCAGTCAGGAAAGTGGCTGACTCCAAGAAGCTGGAGTCCAAGCTGGACTACAAACCTGTGTGATTCACTAGAAGGGTTTGGTGGCTGCATGACAGACATTGGTTTAATGTAAAAATAAAGTTAAGGAAAATAATGTATGTATTGGCAATGATCTTATTAAAAGTGAATAAACATGTATAAGCAACATAATAGTATGTAATTCAGTAATTTTTTAAAAATTGGTACAGAAGAAAGTCATGTTTGGTGATGTTGCATTTACTTCAGCAGAATTTACAAAAGACATCCTGAAGCTTTTCATATTTGCTTTGTGAGCATTTTGTACAACATTCAAAATGATTGAGATAGTAGAGGAGAGCATTTCTTATGACTTATTTTATATTTTGTTTTCCTCGTCCTTAAAAAAAAAGCAATAAAATCTGTTTTAAGTTGTCCTATATATACTCTTGTCTTTTCTAAAAGCACATTTATTCTTGTCCTTTTGGATTAGTAAGTATATGATTTGAAAACCTGGATGAAGTTGAAAATTAAAATAGGGCTTTGAATTTTAAACAGTACTCACAGAGTCCACAAGAATGTCTTCTTTTATAGATCATAGAGTGTGGGGTTATGGAGTATATACATGTACTTGTGTCTTCCAAGAAATTCTCTTTACCTATTGCAGTTAGGTATTTGATAATTTTAACTTTTTAAAGATTATGACTGGAAGTAATACTTATAATTTGGTTTATGTGAAAAATAATTCCCTTTTTGTGGTCTGGATCCAGGAAAAGTCTGTTCATGGACATGTAATTTTACATATATGTGATTTCTAGCGATCTATTATTTCTTAGGTTCACCAGTGGATTCTATAAATATCTTCCAGTAAATACCAGGCTGAGAGTGTCTACTCTATGGAATGTTAAATGTTCAAAACAAAAGTTCTGTTACCTGTACACAATTCTAATTTCATGTGGCAATCAAAAGTTGTATAAGGAAATTGTCAATGTCTAAAAATTGAGATTATTTATAGTTAATTCTTGTTTAAATAAAGACATCAAACTTCAGTTTC