Transcript asmbl_14520

Sequence
Transcript Sequence for observation asmbl_14520 of TGE0032043:
GGTCGCTTCCTGAGCCGCTGCTGGCTCTGTGTCTCTGTCCTCAGCGTTCTCGTCCTCGTCCTCGTCCTCGTCCTACCACGCCATGGAAGGTTACCATAAGCCAGATCAGCAGAAGCTCCAGGCCCTGAAGGACACAGCCAATCGCCTGCGCATCAGCTCCATCCAGGCCACCACCGCGGCAGGCTCAGGCCACCCCACATCATGCTGCAGCGCTGCCGAGATCATGGCTGTCCTGTTTTTCCATACCATGCGTTACAAGGCCCTGGATCCCCGAAACCCTCACAATGATCGATTTGTGCTCTCTAAGGGCCATGCAGCTCCCATTTTATATGCAGTCTGGGCTGAAGCTGGCTTCCTACCCGAGGCCGAGCTGCTGAACCTGAGGAAGATCAGCTCTGACTTGGACGGGCATCCTGTCCCGAAACAAGCCTTCACCGATGTGGCCACTGGCTCCCTGGGCCAGGGCCTGGGAGCTGCTTGCGGGATGGCATACACAGGCAAATACTTTGACAAAGCCAGCTACCGAGTCTATTGCATGCTGGGAGACGGGGAGGTCTCCGAGGGCTCCGTCTGGGAGGCCATGGCCTTTGCTGGAATTTACAAGCTGGACAACCTCGTTGCCATTTTTGACATCAACCGCCTGGGCCAGAGCGACCCAGCCCCGCTGCAGCACCAGGTGGACATCTACCAGAAGCGCTGTGAGGCCTTTGGCTGGCACACCATCATCGTGGACGGACACAGCGTGGAGGAGCTGTGCAAGGCCTTTGGTCAGGCCAAGCACCAACCAACAGCCATCATTGCCAAGACCTTCAAGGGCCGAGGGATCACAGGGATTGAAGACAAGGAGGCGTGGCACGGGAAGCCCCTCCCCAAAAACATGGCCGAGCAGATTATCCAGGAGATTTACAGCCAGGTTCAGAGCAAAAAGAAGATCCTGGCCACGCCCCCTCAGGAGGATGCCCCATCCGTGGACATTGCTAACATCCGAATGCCTACGCCACCCAGCTACAAAGTGGGGGACAAGATAGCCACCCGGAAGGCCTATGGACTGGCCCTCGCTAAGCTGGGCCACGCCAGTGACCGTATCATTGCCCTGGATGGAGACACCAAGAATTCCACCTTCTCGGAGCTCTTCAAAAAGGAGCACCCAGACCGGTTCATTGAGTGCTACATTGCCGAGCAAAACATGGTGAGCATTGCCGTGGGCTGTGCCACACGTGACCGGACAGTGCCCTTCTGCAGTACTTTCGCGGCCTTCTTCACACGGGCCTTCGACCAGATTCGCATGGCCGCCATCTCTGAGAGCAACATCAACCTCTGTGGCTCCCACTGTGGTGTGTCCATTGGGGAAGACGGGCCCTCTCAGATGGCCCTCGAAGACCTGGCCATGTTCCGGTCAGTCCCCATGTCCACCGTCTTTTACCCAAGCGATGGAGTTGCAACAGAGAAGGCAGTGGAGTTAGCAGCCAACACAAAGGGCATTTGCTTCATCCGGACCAGCCGCCCAGAGAATGCCATTATTTATAGCAACAATGAGGATTTCCAGGTCGGCCAAGCCAAGGTGGTCCTGAAGAGCAAGGATGACCAAGTGACAGTGATCGGGGCTGGTGTAACTCTGCATGAGGCCTTGGCTGCTGCAGAGAGTCTAAAGAAAGATAAGATCAGCATCCGGGTGCTGGATCCCTTCACTATCAAGCCCCTGGACAGGAAACTCATCCTAGACTCTGCCCGAGCAACCAAAGGCAGGATCCTCACCGTGGAGGACCACTACTACGAAGGTGGCATAGGAGAGGCAGTGTCTGCTGCCGTAGTGGGTGAACCTGGAGTGACGGTCACTCGCCTGGCTGTCAGCCAAGTACCACGAAGTGGCAAGCCAGCTGAGCTACTGAAGATGTTCGGTATTGACAAGGACGCCATTGTGCAAGCTGTGAAAGGCCTTGTCACCAAGGGCTAGGGAGGGCATGGGATGCTGGGTGGGTGAACTACACATTCCAGGGAGGTTCTGGCAGAGGTGGCGAAGGTGTACTGAGTGGGGAGGTAAATATATGTTTTGAGAAAAAAA