Transcript asmbl_14479

Sequence
Transcript Sequence for observation asmbl_14479 of TGE0032038:
GGGGAGGCCAGGCTTGCGGCGGGGCGCAACGGTGTCTCCTTCACTTCGCCCTCCAGCCGCGGTGGCTGCAGCGCAACTTTCAGATAGCGGAGTGGCCTCAGCTGCGAGCCGAGCGGTGGCGGCAGCGCCCCTCAGGACACCCGCAGATCACCTTTTCCCCGCGACTTCGCCATGGCTGAGTGCTGTGTACCGGTATGCCCACGGCCGATGTGTATCCCTCCACCCTATGCTGACCTCGGCAAAGCTGCCAGAGACATTTTCAACAAAGGATTTGGCTTTGGGCTGGTGAAGCTGGATGTGAAGACGAAGTCATGCAGCGGTGTGGAATTTTCAACATCTGGCTCATCTAATACAGACACTGGTAAAGTTAGCGGGACCTTGGAGACCAAGTACAAATGGTGTGAGTATGGTCTGACTTTCACAGAGAAGTGGAACACCGATAACACTCTGGGGACAGAGATTGCAATTGAAGACCAGATTTGTCAAGGTTTGAAACTGACTTTTGACACCACCTTTTCACCGAACACAGGAAAGAAAAGTGGTAAAATCAAGTCTGCTTACAAGAGGGAGTGTATAAACCTCGGCTGTGATGTTGACTTTGATTTTGCTGGACCTGCCATCCATGGGTCAGCTGTCTTTGGTTACGAGGGCTGGCTTGCTGGGTACCAAATGACCTTTGACAGTGCCAAGTCAAAGCTGACAAGGAGTAACTTTGCAGTCGGCTACAGGACTGGGGACTTCCAGCTACACACAAATGTAAATAATGGGACAGAATTTGGAGGATCAATTTATCAGAAAGTATGTGAAGATTTTGACACTTCAGTAAACCTCGCTTGGACATCAGGTACCAACTGCACTCGTTTTGGCATTGCAGCTAAATACCAGTTGGATCCTACTGCTTCTATCTCTGCAAAGGTCAACAACTCTAGTTTAATTGGAGTGGGCTATACTCAGACTCTGAGGCCTGGTGTGAAGCTTACACTGTCTGCTCTGGTAGACGGGAAGAGCTTTAATGCTGGAGGCCACAAACTTGGGCTTGCCTTGGAATTGGAGGCTTAATCCAGTTAAAAGAAACCTCTGGGAACGAATATCAGAAGATTTGGCCTTAATATATTTCCATGCGACCAGCAGGCTCCCCTTCCTTCCCCCAGAAGGTGATCACATCAAAGGATGATGAAGCAAGAGCTGTATTTTAAATATTTAGACAGTCACTGTTGGCTGGTTCCTAGTTGGATGGTTATCAGTGCTGCCGTGGTGCGGCCCCCTATACATTATTTAAATGTATTTAACTGTTAAATGTGCTACCCACCAATGATGAAATAGACGTTTATGAAAACCGTGCCATGGTGTGCATGTTTGTTTTATGTTCCTTTTAACATTGACTATTGTACTGAATGAGATGGATCAGTGGCTGTTTTAAGATGAGGTAAAAGATTTTTTTTTGTTATATTCACCCATCATTAGAATTACTTTGGTAACCCCAAACATGACAAATTATGAATAAAACAAGTGTACATAACTAATGGCTCACGTATGTGCAGTTACAGATTGCCAGCCTAGGGTCTAATCTTCTTGGCAAATACTTTTTTCTGGTGAGCATTTTGCTCTTTACCTAAACCTGTGCAACCAAATTCCTTGTGTCCCTAGCATAATCCACGAGGTCTTTGAGATTACAATAAAATACAAGGATACATACTTTAATACTCTGCAGTTTCTAAGTTTGTGCAAAGTTAGAGTGAATCACTGTTAACCCATGGATGATGAAGGGAGATGCAGGGGTGGT