Transcript asmbl_14441

Sequence
Transcript Sequence for observation asmbl_14441 of TGE0032031:
CATGATAATGTATTGTAACAAGATTTATTATCTTTTTAAATGTTTCCTAGGTATACAAGGAGCAGGTCCTAGAACCTATGCTTAATGGAACAGATAAAACACCGGCACTGATTTCTGATTACAAAGAATATCATACTGACACAACTGTGAAGTTTGTGGTGAAAATGACAGAAGAGAAACTAGCGCAAGCAGAAGCTGCTGGCCTGCATAAAGTTTTTAAACTTCAAACTACTCTTACTTGCAATTCCATGGTACTCTTTGATCATATGGGTTGTCTGAAGAAGTATGAAACTGTGCAAGACATTTTGAAAGAATTCTTTGATTTACGGTTAAGTTATTATGGTTTACGGAAGGAATGGCTTGTAGGAATGCTGGGAGCAGAATCTACAAAGCTTAATAATCAAGCCCGTTTCATTTTAGAGAAGATACAGGGGAAAATTACTATAGAGAATAGGTCAAAGAAAGATTTGATTCAAATGTTAGTCCAGAGAGGTTATGAATCTGACCCAGTGAAAGCGTGGAAAGAAGCACAAGAAAAGGCTGCAGAAGAGGAAGATTCACAAAACCAACATGATGACAGTTCCTCTGATTCAGGAACTCCTTCAGGCCCTGATTTTAATTATATTTTAAATATGTCTCTATGGTCTCTTACTAAAGAAAAAGTTGAAGAACTCATTAAACAGAGAGATACGAAAGGGCGAGAGGTTAATGATCTCAAGAGGAAGTCTCCTTCAGATCTTTGGAAAGAAGACTTAGCAGCATTTGTTGAAGAATTGGATAAAGTGGAAGCACAAGAGCGGGAAGATATTCTGGCAGGAATGTCTGGGAAAGCAATAAAAGGTAAAGTCGGCAAACCCAAAGTAAAGAAACTTCAGCTGGAGGAGACAATGCCCTCGCCTTACGGGAGAAGAATTGTTCCAGAGATTACTGCTATGAAGGCAGATGCCAGCAGAAAATTGCTGAAGAAGAAAAAGGGTGATCCTGATACCACAGTAGTGAAAGTAGAATTTGATGAAGAATTTAGTGGAACACCAGCAGAAGGTACAGGAGAGGAGACATTGACCCCATCTGCTCCTGTAAATAAAGGCCCCAAACCCAAAAGAGAGAAGAAGGAGCCTGGTACCAGGGTTAGAAAAACACCTACATCAACTGGTAAAACTAATGCGAAGAAAGTGAAGAAACGGAATCCTTGGTCAGATGATGAGTCCAAATCAGAGAGTGACTTGGAAGAAGCAGAACCTGTGGTTATCCCAAGAGATTCTTTGCTTAGGAGAGCAGCTGCTGAAAGACCTAAGTACACTTTTGATTTCTCAGAAGAGGAGGATGATGATGCTGCTGCTGCTGATGACAGTAATGATTTAGAAGAACTGAAAGTTAAAGCATCTCCCATAACAAATGATGGGGAAGATGAATTTGTTCCTTCAGATGGCTTAGATAAAGATGAGTATGCTTTTTCTTCAGGCAAATCCAAAGCTACTCCAGAAAAATCTTCAAATGACAAAAAAAGTCAGGATTTTGGAAATCTTTTTTCATTTCCTTCATATTCTCAGAAGTCAGAAGATGATTCAGCTAAATTTGACAGTAATGAAGAAGATACCGCTTCTGTTTTTGCTCCATCATTTGGTCTGAAGCAAACAGATAAACTTCCAAGTAAAACAGTTGCTGCTAAAAAGGGTAAACCACCTTCAGATACAGCCCCTAAAGCTAAGAGAGCCCCTAAACAGAAGAAGATAGTAGAGACTATAAACTCTGACTCAGACTCTGAATTTGGCATTCCAAAGAAGACTACAACACCAAAAGGTAAAGGCCGAGGGGCAAAGAAAAGGAAAGCATCAGGCTCAGAAAATGAAGGTGATTATAACCCTGGAAGGAAACCATCTAAAACAGCCAGCAAGAAACCGAAGAAAACATCTTTTGATCAGGATTCAGATGTAGACATCTTCCCCTCAGACTTCACTTCTGAACCACCGGCTCTCCCACGGACTGGTCGGGCTAGGAAAGAAGTAAAATATTTTGCAGAGTCTGATGAAGAAGAAGATGTTGATTTTGCAATGTTTAATTAAGTGCCCAAAGAGCACGAACATTTTTCAAAAATACCTTGTGTTGTCCTTTGTCTTTTCTGTCTCAGAATTTTGTACATCTGGCTTATTTTAATGTGATGATGTAATTGATGGTTTTTTATTATTGTGGTAGGCCTTTTAACATTTTGTTCTTACACATACAGTTTTATGCTCTTTTTTACTCATTGAAATGTCATGTGTTGTCTGATTGGCTTGTAGAATTGTTATAGATTACCGTGCATTAGCACAGATTTTAATTGTCATGATTGCAGACTACAGATCTGCTTTTTGAAATGAAATTTAAACATTAAAAATGGAACTG