Transcript asmbl_14412

Sequence
Transcript Sequence for observation asmbl_14412 of TGE0032028:
CAGCTTCTGCCAAAGCCAGCAACTCTGGGAAAGAGTCTGCTCCTTGAATACCTCTGCAGGTGTCAACAAGGCTCAAGGAGCAGGATGGATCTCGATGTGGTTAACATGTTTGTGATTGCGGGTGGGACCCTGGCCATTCCAATCCTGGCATTTGTTGCGTCTTTCCTCCTGTGGCCTTCAGCACTGATAAGAATCTATTATTGGTACTGGCGGAGGACACTGGGCATGCAAGTTCGCTACGCACACCATGAGGACTATCAGTTCTGTTACTCCTTCCGGGGCAGGCCAGGACACAAGCCATCCATCCTTATGCTCCATGGATTCTCCGCACACAAGGACATGTGGCTCAGCGTGGTCAAGTTCCTTCCGAAGAACCTGCACTTGGTCTGTGTGGACATGCCTGGGCATGAAGGCACCACCCGCTCCTCCCTGGATGACCTGTCCATAGTGGGGCAAGTTAAAAGGATACATCAGTTTGTAGAATGCCTTAAGCTGAACAAAAAGCCCTTTCACCTTATAGGCACCTCCATGGGTGGCCACGTGGCTGGAGTATATGCCGCTTACTACCCATCTGATGTCTGCAGCCTGTCTCTCGTGTGTCCTGCTGGCCTGCAGTACTCAACTGACAATCCTTTTGTACAACGGCTCAAAGAGCTGGAGGAGTCAGCTGCCATTCAGAAGATTCCCTTGATCCCATCCACCCCGGAAGAGATGAGTGAGATGCTGCAGCTCTGCTCCTATGTCCGCTTCAAGGTGCCCCAGCAGATCCTTCAAGGTCTTGTCGATGTTCGCATTCCTCATAACAGCTTCTACCGGAAATTGTTTTTGGAAATCGTCAATGAGAAATCCAGATACTCTCTGCATGAGAATATGGACAAGATCAAGGTCCCGACACAGATCATTTGGGGGAAACAAGACCAGGTGCTTGATGTGTCCGGGGCAGACATATTAGCCAAGTCAATCTCTAACTCCCAGGTAGAGGTTCTGGAAAACTGTGGCCATTCGGTAGTGATGGAGAGACCGAGGAAGACAGCCAAGCTCATTGTCGACTTTTTAGCTTCTGTGCATAACACAGACAACAAGAAGCTGAACTGAGGCTGTTGCCACAGCTTGCATTGTGCACACAGCATCTGCTCCCATCCCCAAAACCTGACACAGTAACCACTCTCAGGGATCCTGCCCCAAATGCTGTCTGAGCACCAACAGCCCTGAGGAAGCCAGTTGCCTATCCCAGTATCCTTGGTTCCACAGAGCATCAGGGGCCACAAGAAACTCTCCAGGATCCTTTTTTTCAAAATAGAAACCTAAATGGAACAAACAAACAAAAAAAAAACAAATAAAAAAATCTAGCCATGAAGCCTACCAGAAGTCTTCAAGTTCATGTCACTGAGAAGCCAGTGCTAGGCAGCCACCCTGGACCACGAGCACCACGGACACTTTCTTTAAGACATTCCTCATACATTAAACATCATCTATTTCCGTTGTTGTTGTTGCTTCCGATGTATCCTCTGCATGGTCAGTGGCTTCTTCTACAGGAGCTTTAGTCATTTACTGAAAACTCTTGTTTAGAGCTAAGTCAAGTTTTACATATAGGCCACGTGTGAATGCAGCTGCCCGTTAACCCAAGACCAGGGAAGAGACAGCGAACTGTGGAAGAGGTTTCTGCCTCGAGGCCTGATACACAGGAGGCTGAGGCAGAAGGATCCAAGGTCAAGGCCTGCCAGACAGGTACAGAGTGAGTTCAAGGCCAGCCTGAGCTACTGACTGAGAAGAGAAAATGTTTCTACCTTTTTTGATGTAGAAATGTACATGGGGGGTGGGGTGGGGCATTGCTCCACCTCGGTCAGCCCTAAGAATTGACCAAGAGGGAGAACATACAGACTGATGAGTTTGGGCACCCACAGATCAGATGCATCTGACCAACCACAGAAGAACACCTGACTGGGAAGGTGCTCTAGGAATGATTTACAACTTTAGAAATAGG