Transcript asmbl_14410

Sequence
Transcript Sequence for observation asmbl_14410 of TGE0032026:
GTCTATGGCCAAGGCCTGTCAGAAGGCCGGACTTTTGAGATGTCAGACTTCATCGTGGACACAAGAGATGCAGGCTATGGTGGCATATCCTTGGCAGTAGAAGGACCCAGCAAGGTGGACATCCAAACAGAGGACCTGGAGGACGGCACCTGCAAGGTGTCCTACTTCCCCACTGTGCCCGGGGTCTATATCGTCTCCACCAAATTTGCTGACGAGCATGTGCCTGGAAGCCCATTCACTGTGAAGATCAGTGGCGAGGGAAGAGTCAGAGAGAGCATCACCCGGACCAGCCGGGCTCCGGCTGTGGCCACGGTTGGCAGTATCTGTGACCTGAACCTGAAGATCCCGGAGATCAACAGCAGTGACATGTCTGCCCATGTCACCAGCCCCTCTGGCCATGTCACTGAGGCAGAGATTGTGCCCATGGGAAAGAACTCTCACTGTGTCAGATTTGTGCCCCAGGAGATGGGCGTTCACACTGTCAGCGTAAAGTACCGCGGACAGCACGTAACAGGAAGCCCGTTCCAGTTCACCGTGGGGCCCCTTGGCGAAGGGGGTGCCCACAAGGTCCGGGCAGGAGGCCCTGGCCTGGAGAGGGGAGAAGCAGGCATCCCAGCTGAGTTCAGCATCTGGACCCGGGAAGCAGGTGCTGGCGGCCTCTCCATTGCTGTTGAGGGCCCTAGTAAGGCCGAGATCACATTCGATGACCATAAAAATGGGTCATGCGGTGTGTCTTATATTGCCCAAGAGCCTGGTAACTACGAGGTGTCTATCAAGTTCAACGACGAGCACATCCCGGACAGCCCTTACCTGGTGCCCGTCATCGCGCCCTCAGACGACGCTCGCTGCCTCACTGTTCTGAGCCTTCAGGAATCAGGATTAAAAGTTAACCAGCCAGCGTCCTTTGCTATAAGGTTGAATGGTGCGAAAGGGAAGATTGATGCAAAGGTGCACAGCCCCTCAGGAGCCGTGGAGGAATGCCACGTGTCTGAACTGGAGCCAGATAAGTATGCCGTTCGCTTCATCCCGCATGAGAATGGCATCCACACGATCGATGTCAAGTTTAACGGGAGCCACGTGGTCGGGAGCCCTTTCAAAGTACGTGTAGGAGAGCCTGGCCAGGCAGGCAATCCTGCTCTAGTGTCAGCCTACGGTGCTGGGCTTGAGACGGGCACCACAGGTATCCAATCAGAATTCTTCATCAATACCACTCAGGCAGGCCCAGGGACATTATCTGTCACCATTGAAGGACCATCCAAGGTCAAAATGGATTGCCAGGAAATCCCAGAGGGGTACAAAGTCATGTACACTCCCATGGCTCCTGGAAATTACCTGATTGGTGTCAAATATGGCGGGCCCAACCACATCTCGAGGAGTCCATTCAAGGCCAAGGTGACAGGCCAACGTCTGGTCAGCCCAGGCTCAGCCAACGAGACCTCCTCCATCTTGGTGGAGTCCGTAACCAGATCCTCAACGGAAACGTGCTATAGCGCCATTCCCAAGTCGTCCTCCGATGCCAGCAAAGTGACCTCCAAGGGCGCAGGCCTGTCAAAGGCTTTTGTGGGCCAGAAGAGTTCTTTCCTGGTGGACTGCAGCAAAGCTGGGTCCAACATGCTGTTGATTGGGGTCCATGGGCCCACCACCCCCTGTGAAGAGGTCTCCATGAAGCATGTGGGCAAGCAACAGTACAACGTCACCTACGTCGTCAAGGAGAGGGGCGATTACGTTCTGGCTGTGAAGTGGGGGGAAGAGCACATCCCCGGTAGCCCCTTTCATGTCACCGTGCCTTAAAGCATCTGATAGCCAATGCTGGACGTGTCCCTTCCGGTTGCTTTTGTTGCTAGTTTGTAATTCATTTTTTACAATGTCCACAGCCTGCTGGTGGGCCAGCGTCCCCATCCCAAACCTTGCCGCTCACTCCAAGTGCCTTGGTGCCCTAGACTTGACTCGAGGTCATGTGGGACATCTTCAGAAAGCAAGCTGGGGCCAAAAAAGTGCAGAGCCCTCTGCCCAAATCAAGACTCTTAATTTCAAAGGTCATTGCAGACGGAACAAGAACATGGACAGGACTGACTGGCTCTCCTAAGCTTCTGGTCTACTCAAGCGATAACCAAACAAGAATGTCATTGCAGAAGGGGGTCCTGCACCCCACTTGCCAAAGAACAGTGCAACCCACTTTCCTCAAGACTAGACAACAAATAAGAAAGTCTGACCCAGATTATACTCCATGCCTGGGCTTCGTCTTGGGGCCCTGATCACTTTGACTTCATCCTAAAGCCAGCTCTGGAGCAGAAGGCATGCAGAACACTCCATACCCCATTTTTGGAATTCTGTACCTGCCTACTTCTTTATTAACAGCCTTGAAGGCATGTGCTCATGGCCAAATGCAGGGCCTCTGCCAGCTGCCCCCAGAGTTCATTGCGGCTGCTAAATGGCAGAGACCACTGATAAATTATTTCAGGACCTCCTCCTTGCAAAAGCTGGAAGGGATGGGTACCCCTCTTATGACCCATGAGAGGCCTTAATGACCAAGACACTAGCACGTGCACCCACCTGAGGTCTCTAAAGGTTTTGGTGTAAGCATTGTCAGGCTGTCAAATGGCTGGAGCGAGTGTTACACACACACACACACACAC