Transcript asmbl_14409

Sequence
Transcript Sequence for observation asmbl_14409 of TGE0032024:
TCCCATTCCTAAAAGTCCTTTCACTGTGGGCGTTGCTGCGCCACTGGATCTGAGCAAGATAAAAATTAATGGACTGGAAAACAGAGTTGAGGTTGGAAAGGACCAGGAATTTGCCATTGACACCAACGGGGCAGGAGGCCAGGGGAAGCTGGATGTGACCATCCTGAGCCCTTCTCGGAAGGTGGTGCCATGCTTGGTAGCACCAGTGGCTGGCAGGGAATGCAGCACAGCCAAATTCATCCCTCGGGAGGAGGGGCTGTTTGCTGTAGATGTGACCTATGATGGACACCCAGTGCCCGGGAGCCCCTATACTGTGGAGGCCTCACTACCACCAGATCCCACCAAGGTGAAGGCCCACGGTCCTGGCCTTGAAGGAGGTCTTGTAGGCAAGCCCGCTGAGTTCACCATTGACACTAAAGGAGCTGGAACTGGAGGTTTGGGCCTAACTGTGGAAGGTCCATGTGAGGCCAAAATCGAATGCTCGGATAACGGTGACGGGACCTGCTCCGTCTCCTACCTTCCCACAAAACCCGGAGAATACTTTGTCAACATTCTCTTTGAAGAAGTCCACATTCCTGGATCTCCCTTCAAAGCCGACATTGAAATGCCGTTTGACCCCTCTAAGGTTGTAGCGTCAGGACCAGGACTTGAACACGGAAAAGTGGGTGAACCCGGAATCCTTTGCGTTGATTGTTCAGAAGCAGGGCCTGGGACTCTGGGCCTTGAAGCCGTCTCAGACTCAGGGGCGAAAGCTGAAGTGTCCATCCAGAACAATAAAGATGGCACCTACGCTGTGACCTATGTGCCTCTGACAGCTGGCATGTACACACTGACCATGAAGTATGGTGGTGAGCTTGTACCACACTTTCCTGCCTGGGTCAAGGTGGAGCCAGCCATAGACACTAGTGGGATCAAAGCCTTTGGGCCAGGAATCGAAGGCAAGGACGTGTTTCGGGAGGCCACAACGGACTTCACGGTTGACTCGAGGCCCCTTACCCAGGTTGGAGGTGACCATATCAAAGCTCAAATTACCAACCCCTCGGGGGCCTCCACCGAGTGCTTTGTCAAGGACAATGCTGATGGGACCTATCAGGTCGAATACACGCCCTTTGAGAAAGGTTTCCATGTAGTGGAGGTGACATACGATGATGTGCCCATCCCAAATAGCCCATTCAAAGTGGCTGTCACTGAAGGCTGCCAGCCATCTCGGGTCCATGCGCAAGGCCCTGGACTGAAAGAGGCGTTTACCAACAAATCTAATGTCTTCACAGTGGTAACCAGGGGAGCAGGGATCGGTGGGCTTGGCATAACTGTGGAGGGGCCGTCGGAGTCAAAGATAAACTGCAGAGACAACAAGGATGGCAGCTGCAGTGCTGAGTACATTCCTTTCGCTCCAGGGGATTATGACGTCAATATCACGTACGGAGGCGTCCACATCCCTGGCAGCCCCTTCAGAGTTCCTTCAAAAGATGTTGTGGATCCCAGCAAGGTCAAGATTGCTGGCCCCGGTCTGAGCTCCTGTGTCCGAGCATGCATCCCGCAGTCCTTCACAGTGGACAGCAGCAAGGCTGGCCTAGCTCCCCTGGAAGTGAGGGTCCTGGGCCCAAGAGGCCTCGTGGAGCCGGTGAATGTGGTAGATAATGGGGACGGCACCCACACAGTGACCTACACGCCATCTCAGGAGGGGCCCTACATTGTTTCCGTCAAATATGCTGATGAAGAGATCCCCCGAAGTCCCTTTAAGGTCAAGGTTCTTCCCACATACGATGCAAGCAAAGTGACAGCCTCTGGGCCTGGCCTCAGCGCCTATGGGGTACCCGCCAGCCTACCTGTGGAGTTCGCCATTGATGCCAGAGATGCTGGCGAAGGCCTGCTTGCTGTCCAGATCACGGACCAGGAGGGAAAGCCTCAAAGAGCTACTGTCCACGACAACAAAGATGGCACATATGCCGTTACCTATATCCCTGATAAGACCGGACGCTATATGATTGGAGTCACCTATGGTGGAGACAACATTCCACTTTCTCCTTACCGTATCCGGGCCACACAGACAGGCGATGCCAGCAAGTGCTTGGCCACAGGTCCTGGTATTGCCCCCACTGTGAAAACTGGCGAGGAGGTGGGCTTTGTAGTGGACGCTAAGACTGCAGGGAAGGGGAAAGTAACCTGCGTGATTCTGACCCCAGATGGCACCGAGGCTGAGGCTGACGTCATTGAAAATGAAGATGGCACCTATGACATTTTCTACACTGCTGCCAAGCCAGGCACCTATGTTATCTATGTGCGCTTTGGTGGCGTTGATATTCCCAATAGCCCCTTCACAGTCATGGCCACCGATGGGGAAGTCACAGCCATGGAGGAGGCACCGGTAAATGCATGTCCCCCTGGATTCAGGCCCTGGGTTACAGAAGAGGCCTATGTCCCTGTGAGTGACATGAACGGGCTAGGCTTCAAGCCCTTTGACTTGGTGATTCCATTTGCCGTCAGGAAAGGAGAAATTACAGGCACGGTGCATATGCCTTCTGGGAAGAAGGCTACACCTGAGATTGTGGACAACAAGGACGGCACGGTCACTGTGAGATACGCGCCCACTGAAGTCGGCCTCCACGAGATGCACATCAAGTACAGGGGCAGCCACATCCCGGAGAGCCCCCTGCAGTTCTACGTGAACTACCCCAACAGTGGGAGTGTGTCTGCTTATGGTCCAGGCCTTGTGTATGGAGTAGCCAACAAAACTGCCACCTTCACCATTGTCACAGAGGATGCGGGAGAAGGTGGTCTGGACTTGGCTATTGAAGGACCCTCGAAAGCAGAGATCAGCTGCATTGACAACAAAGACGGGACATGTACAGTGACCTACCTACCCACCTTGCCAGGGGACTACAGCATTCTGGTCAAGTACAATGACAAACATATTCCTGGCAGCCCCTTCACTGCCAAGATCACAGATGATAACAGACGCTGCTCCCAAGTGAAGCTGGGCTCAGCTGCTGACTTCCTTCTGGACATCAGTGAGACAGACCTTAGCACACTGACAGCCAGTATCAAGGCCCCATCTGGACGTGACGAGCCCTGTCTGCTAAAGAGGCTACCCAACAACCACATTGGCATTTCCTTCATCCCCCGAGAAGTGGGTGAGCATCTAGTCAGCATCAAGAAAAACGGTAACCACGTGGCCAACAGCCCTGTGTCCATTATGGTGGTCCAGTCTGAAATTGGTGATGCACGCCGAGCCAAAGTCTATGGCCAAGGCCTGTCAGAAGGCCG