Transcript asmbl_139

Sequence
Transcript Sequence for observation asmbl_139 of TGE0032015:
GCCGAGGTGAAAGAACGAGCCCCCCTCCCGGAAATGACGCCACTTGACCTTTCACCCACGGGACGCGCGGGGCCTTCCGGAAGGTTCTAGAACGGACCGTGGCCCAGGAACCAGCGTAGGGCGGCGGGAGAGGGCTGAGGCCGCAGAGCTGAGGCGGCTCTGAAATGCTTCGACTACCCACAGTCCTTCGCCAGATGAGACCAGTGTCCCGGGCACTGGCTCCTCATCTCACTCGGGCCTATGCCAAAGATGTAAAATTTGGTGCGGACGCTCGAGCCTTAATGCTTCAAGGTGTAGACCTTTTAGCAGATGCTGTAGCTGTTACAATGGGGCCAAAGGGAAGAACTGTGATTATTGAACAGAGTTGGGGAAGTCCCAAAGTAACAAAAGATGGGGTCACTGTTGCAAAGTCAATTGATTTAAAGGATAAATACAAAAATATTGGAGCTAAACTTGTTCAGGACGTTGCCAATAACACAAACGAAGAGGCTGGGGATGGCACCACCACTGCCACTGTTCTGGCACGATCTATTGCCAAGGAGGGCTTTGAGAAGATCAGCAAAGGGGCTAATCCAGTGGAAATCCGGAGAGGTGTGATGTTGGCTGTGGATGCTGTAATTGCTGAACTTAAGAAACAGTCTAAACCTGTGACAACCCCTGAAGAAATTGCTCAGGTTGCTACAATTTCTGCAAATGGAGACAAAGACATTGGGAACATCATTTCTGATGCAATGAAAAAGGTTGGAAGAAAGGGTGTCATCACAGTGAAGGATGGAAAAACCCTGAATGATGAGCTAGAAATTATTGAAGGCATGAAGTTTGATAGAGGATATATTTCCCCGTATTTTATTAACACATCAAAAGGTCAAAAGTGTGAATTCCAAGATGCCTATGTCTTGTTGAGTGAAAAGAAAATTTCCAGTGTTCAGTCCATTGTCCCTGCTCTTGAAATTGCTAATGCTCATCGGAAGCCATTGGTCATAATCGCCGAAGACGTTGACGGAGAAGCTCTAAGCACGCTGGTTTTGAACAGGCTAAAAGTTGGTCTTCAGGTTGTGGCAGTCAAAGCTCCAGGATTTGGGGACAATAGGAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGAAGAGGGGTTGAATCTAAATCTTGAAGATGTTCAAGCTCATGACTTAGGAAAAGTTGGGGAGGTCATTGTCACCAAAGATGATGCCATGCTTTTGAAAGGAAAAGGTGACAAAGCTCACATTGAAAAACGTATTCAAGAAATCACTGAGCAGCTAGACATCACAACTAGTGAATATGAAAAAGAAAAGCTGAACGAGCGACTTGCTAAACTTTCAGATGGAGTAGCTGTGTTGAAGGTTGGAGGAACAAGTGATGTTGAAGTGAATGAGAAAAAAGACAGAGTTACTGATGCTCTCAATGCTACAAGAGCAGCTGTTGAAGAAGGCATTGTTCTAGGAGGGGGCTGCGCTCTGCTTCGGTGCATCCCAGCCTTGGATTCATTAAAGCCTGCTAATGAAGACCAGAAAATAGGTATAGAAATTATTAAAAGAGCACTTAAAATTCCTGCAATGACGATTGCTAAGAATGCAGGTGTTGAAGGATCTTTGATAGTTGAGAAAATTCTGCAGAGTTCCTCAGAAGTTGGTTATGACGCCATGCTTGGAGATTTTGTGAACATGGTGGAAAAAGGGATCATTGATCCAACAAAGGTTGTGAGAACTGCCTTACTGGATGCTGCTGGGGTGGCCTCCTTGCTAACTACAGCCGAAGCTGTAGTGACAGAAATTCCTAAAGAAGAGAAGGACCCTGGAATGGGTGCAATGGGTGGCATGGGAGGGGGTATGGGAGGCGGCATGTTCTAACTCCTAGAGTAGTGCTTTGCCCTTATCAATGAACTGTGACAGGAAGCTCAAGGCAGGTTCCTCACCAATAACTTCAGAGAAGTCACCTGGAGAAAATGACTGAAGAGAAGGCTGGCTGACCACTGTAATCATCAGTTACTGGTTTCCTTTGACGATATATAATGGTTTACTGCTGTCATTGTCCATGCCTACAGATAATTTATTTTGTATTTTTGAATAAAGACATTTGTACATTCCTGATGCTGGGTGCAAGAGCCATATACCAGTGTCCTGCTTTCAACTTAAATCACTGAGGCATCTCTACTGTTCTGTGAGCATCAGGACTGTAGCGCTGTGTCACCACATGAGAGTTCAGAAGCAGCCTTTCTGTGGAGGGTGGGAATGATTGTGTACAAAGTAGAGAAGTATCCAATTATGTGACAACCTTTGTGTAATAAAATTTTGTTTAAAGTT