Transcript asmbl_13439

Sequence
Transcript Sequence for observation asmbl_13439 of TGE0032012:
TCGCTGTGTGCGCTCCGCGTGTGCAGCCGCGTGGGCCATGGGGCGGCGGGCGCGGGGCCGGCGGTTCCAGCAGCCGCCGCAGCCTGAGGGCGAGGAAGACGCCAGCGACGGCGGCAGAAAGCGAGGCCAGGCGGGCTGGGAAGGTGGCTATCCCGAGATCGTAAAGGAGAACAAGCTCTTCGAGCACTACTATCAGGAACTCAAGATCGTGCCAGAGGGAGAATGGGACCAATTCATGGAGTCACTCCGAGAACCTCTCCCAGCCACACTGAGAATCACTGGGTACAAAAGCCATGCCAAAGAGATTCTCCATTGCTTGAAGAACAAGTACTTTAAGGAGTTGGAGGACCTGGAAGTAGATGGACAGAAAGTTGAAGTTCCACAACCACTAAGCTGGTACCCTGAAGAACTTGCCTGGCATACAAACTTAAGTCGGAAAATCTTGAGGAAGTCCCCGTTGTTGGCAAAGTTCCATCAGTTCCTGGTCAGCGAGACTGAGTCTGGAAACATCAGCCGCCAGGAGGCTGTCAGCATGATCCCCCCACTGCTGCTCAACGTGGAGCCACACCATAAGATCTTAGACATGTGTGCAGCCCCTGGATCCAAGACCACACAGTTAATTGAAATGTTGCATGCAGACATGAGTGTGCCCTTTCCAGAGGGATTTGTAATCGCAAATGACGTGGACAACAAGCGCTGCTATCTGCTCGTCCATCAGGCCAAAAGGTTGAGCAGTCCCTGCATCATGGTGGTAAACCATGACGCATCCAGCATACCTAGACTTACAGTAGATGTGGACGGAAGGAAAGAGATTCTCTTCTATGATCGAATTTTATGTGATGTCCCTTGCAGTGGCGATGGCACAATGAGAAAAAACATTGATGTCTGGAAGAAATGGACAACCTTAAACAGCTTGCAGCTCCATGGCCTGCAGCTTCGGATTGCAACTCGAGGTGCTGAGCAGCTGGCGGAAGGTGGCAGGATGGTGTATTCCACGTGTTCCTTGAACCCCGTGGAGGATGAAGCAGTGATCGCAGCTCTGCTAGAGAAGAGTGAAGGAGCTCTTGAGCTTGCTGATGTGTCTGCTGAGTTGCCAGGACTGAAGTGGATGCCTGGAGTCTCACAGTGGAAGGTCATGACTAGAGACGGGCAGTGGTTTGCAGACTGGCATGAGGTTCCCCAGGGCAGGCATACACAAATCCGACCTACCATGTTCCCACCAACGGACCTGGAGAAGCTACAGGCAATGCATCTAGAGCGATGCCTTCGAATCCTGCCCCATCATCAGAATACTGGAGGGTTCTTTGTGGCAGTATTGGTCAAGAAAGCACCAATGCCGTGGAACAAACGTCAGCCCAAGGTCCAGAATAAATCTGCAGAAGCCAGAGAACCCAGGGTATCCAGCCATGTGGCTGCCACAGAGGGAAATCCCAGTGACCAGTCTGAGCTGGAAAGTCAGATGATAACTGGAGCTGGTGACTCAGAAACAGCTCACAACACTGAGAACACAGAGAGCAATGAGAAGAAAGATGGCGTGTGTGGCCCTCCTCCATCAAAGAAAATGAAGTTGTTTGGATTTAAAGAAGATCCATTTGTATTCATTCCTGAAGATGATCCTTTATTTCCACCTATTGAGAAGTTTTATGCCTTGGATCCTTCATTCCCGAGGATGAATCTGTTAACCCGAACCACAGAAGGAAAGAAGCGGCAGCTTTATATGGTCTCCAAGGAGCTGAGGAATGTACTGCTGAACAACAGCGAGAAGATGAAGGTCATTAACACTGGGATAAAAGTCTGGTGTCGAAATAACAGTGGTGAAGAATTCGATTGTGCATTCCGTTTGGCACAGGAGGGAATATATACATTGTATCCATTTATCAATTCAAGAATCATCACTGTATCAATGGAAGACGTGAAGACACTGTTGACCCAGGAGAACCCATTCTTTAGAAAACTGAGCAGTGAGGCCTACAGTCAAGTCAAGGACCTTGCAAAGGGAAGTGTTGTGCTGAAGTATGAGCCAGATTCTGCGAATCCAGACACCCTCCAGTGCCCCATCGTGCTGTGTGGGTGGCGGGGAAAGGCCTCTATTCGAACTTTTGTGCCCAAAAATGAGCGGCTTCATTATCTCAGGATGATGGGTCTGGAGGTACTGGGAGAAAAGAAGAAAGAGGGAGTCATTCTTACCAATGAGAATGCTGCCAGCCCAGAGCAGCCTGGAGATGAGGATGCCAAGCAGACAGCACAAGACCCCTGCGTCCCAGACTCCGTCCCTGGCTGTGATGCAGCTGCAGCTGAGCCATCCCGGTGAAGGAGTCTTCACACAATGAATTGGTACCATCCGTTGTTGGAGATCAAACCTAGAATGTCCTTAGCCAGGGACCTGGAAATGAGTGGTGGCCACAGTCTGTTAGGAGTCGCTTTTGCAGAGTGGATACATGTTTCTGCTGTTAAAGGCTAACAGCCTTTGCAGAAGTTCAGATCCCTTGTTGGCCAGTATTGACCTAGTCTTCTAAAACGACAGTAAAAGTCTACAAGTCTTTGGGAAGCAGCTCTATCTATCTATGCTTTAATACTTTCTGGACTGCACACCAGTGTGCTGTGCAGTCATGCTGACACTGAGGTCTCAGGTGACTTCTGTGCCTTTGTGATAAAGGGTGAGATAAGCCATCTCAGAGGGAAGGCTGGTGAATCATGACAGCAGTTTTGGGGACCGTTTGTGCTTATCCTGGAGTTGTTTTAAGTGGGGTGGAGATTGCTTGGGTCATGAAATAAAGAGCTATTATGATCATGTATCTTGGCATGAGACTTGGATTTGCTTTTAGTTGGCTAATGGGAGAGAAAAGCCAGCCCTCTGGTGTCTCATACAGGA