Transcript asmbl_13436

Sequence
Transcript Sequence for observation asmbl_13436 of TGE0032011:
GATCGTCAGGAGCAGCGCCGGGAGCTGAAGCGAGCTGGAGGACTCATGTTCAACACAGGGATCGGACAACACATTTTGAAAAATCCTCTAATTGTTAACAGCATCATCGATAAGGCTGCTTTAAGACCTACCGATGTGGTGCTGGAAGTTGGGCCTGGGACTGGCAATATGACTGTCAAGCTGTTAGAAAAGGCCAAAAAGGTAGTTGCCTGTGAACTTGATCCAAGGCTAGTAGCTGAACTTCACAAAAGAGTTCAGGGCACGCCTCTGGCCAGCAAACTCCAGGTCCTGGTGGGAGATGTACTGAAATCAGATTTGCCATTCTTTGATGCTTGTGTGGCAAACTTGCCTTATCAGATCTCCTCTCCCTTTGTCTTCAAGTTGCTGCTCCACCGGCCATTTTTCAGATGTGCTATACTTATGTTTCAGAGAGAGTTTGCTCTTCGATTGGTTGCCAAGCCTGGAGATAAATTATACTGTAGACTCTCCATCAACACACAGCTTTTAGCACGCGTGGACCATCTAATGAAGGTGGGGAAGAATAACTTCAGACCGCCCCCCAAGGTGGAGTCCAGCGTGGTCAGGATAGAACCTAAGAATCCGCCACCACCAATCAATTTTCAGGAATGGGACGGCTTAGTAAGGATCACTTTTGTTCGGAAAAACAAGACACTGTCCGCTGCATTCAAATCAAGTGCAGTACAACAACTGTTGGAAAAAAATTACAGAATTCACTGTTCAGTACAGAATACTGTAATACCAGAAGATTTCAGTATAGCAGATAAAATACAGCAAATCCTAACCAGCACAGGTTTCAGTGACAAACGGGCCCGTTCCATGGACATAGATGACTTCATCAGGTTGCTACATGGATTCAATGCAGAAGGCATCCACTTCTCCTAGCCATTTGAAAACTATTTTTTCAAGACCAAGAAAAAATGAAATTATACAATCCTACTATTTGAGAATACAACCAATTTTGTTCTACAGGACATCATTTAAATTATTT