Transcript asmbl_13411

Sequence
Transcript Sequence for observation asmbl_13411 of TGE0032004:
GGCAAACGTGAAGAGCTCTCGGGCTTCTGCTGTGCCGCAGCGGGGATCTGGATCTGGAAGACTACTCTCCTGCAGCTGAAACATGGGCGGCAAAAATAAGAAACACAAGGCGCCGGGAGCTGCGGCGATGCGGGCCGCCGTGTCTGCTTCCAGAGCCAGAAGTGCAGAGGCCGGAGCTGTTGGGGAAGCCCAGAGCAAGAAGCCGGTGGCCAGGCCGGCGCCCGCCGTCCCCACCGGCGCCCGGGAGCCCCGAGTGAAGCAAGGTCCAAAAATTTATAGTTTTAATTCTGCAAATGATTCCGGTGGCTCTGCAAATCTGGACAAATCTATTTTGAAAGTGGTGATTAACAATAAACTAGAGCAAAGGATTATCGGAGTGATCAATGAGCATAAAAAGCAGAACAGCGACAGGGGAGCGATCTCTGGAAGACTGTCGGCTAAGAAGCTACAGGTGTTTCTCACCGCCACCTTTCATCCCGGGGCAGGGTCCCTGCGCCCAGTGCTAC