Transcript asmbl_13142

Sequence
Transcript Sequence for observation asmbl_13142 of TGE0031983:
ACCCAGTTTTTTCCCAACCCCCACTCATCCTCTTCCTGCTGTGGTCGCCAGAGCCAGAAGCAGCCTGTCTCCCCGCCCCTGAGCAGGAGCACAAAACCAGAAGTCCCTGCCTTGTACAGGCAGCTCTGAAAGCCTACTGGGAGCATCAAGGCTGCAAACGCTGGATTGAGAAGCCGCAACTGTGACTCTGCATCATGAATACTCTGTCTGAAGGAAATGGCACCTTTGCCATCCATCTTTTGAAGATGCTATGTCAAAGCAACCCTTCCAAAAATGTATGTTATTCTCCTGCGAGCATCTCCTCTGCTCTAGCTATGGTTCTCTTGGGTGCAAAGGGACAGACGGCAGTCCAGATATCTCAGGCACTTGGTTTGAATAAAGAGGAAGGCATCCATCAGGGTTTCCAGTTGCTTCTCAGGAAGCTGAACAAGCCAGACAGAAAGTACTCTCTTAGAGTGGCCAACAGGCTCTTTGCAGACAAAACTTGTGAAGTCCTCCAAACCTTTAAGGAGTCCTCTCTTCACTTCTATGACTCAGAGATGGAGCAGCTCTCCTTTGCTGAAGAAGCAGAGGTGTCCAGGCAACACATAAACACATGGGTCTCCAAACAAACTGAAGGTAAAATTCCAGAGTTGTTGTCAGGTGGCTCCGTCGATTCAGAAACCAGGCTGGTTCTCATCAATGCCTTATATTTTAAAGGAAAGTGGCATCAACCATTTAACAAAGAGTACACAATGGACATGCCCTTTAAAATAAACAAGGATGAGAAAAGGCCAGTGCAGATGATGTGTCGTGAAGACACATATAACCTCGCCTATGTGAAGGAGGTGCAGGCGCAAGTGCTGGTGATGCCATATGAAGGAATGGAGCTGAGCTTGGTGGTTCTGCTCCCAGATGAGGGTGTGGACCTCAGCAAGGTGGAAAACAATCTCACTTTTGAGAAGTTAACAGCCTGGATGGAAGCAGATTTTATGAAGAGCACTGATGTTGAGGTTTTCCTTCCAAAATTTAAACTCCAAGAGGATTATGACATGGAGTCTCTGTTTCAGCGCTTGGGAGTGGTGGATGTCTTCCAAGAGGACAAGGCTGACTTATCAGGAATGTCTCCAGAGAGAAACCTGTGTGTGTCCAAGTTTGTTCACCAGAGTGTAGTGGAGATCAATGAGGAAGGCACAGAGGCTGCAGCAGCCTCTGCCATCATAGAATTTTGCTGTGCCTCTTCTGTCCCAACATTCTGTGCTGACCACCCCTTCCTTTTCTTCATCAGGCACAACAAAGCAAACAGCATCCTGTTCTGTGGCAGGTTCTCATCTCCATAAAGACACATATACTACACAGGGAGAGTTCTCTCTTCAGTATCCCTACCACTCCTACAGCTCTGTCAAGATGGGCAAGTAGGGGGAAGTCATGTTCTAAGATGAAGACACTTTCTTCTTGTCAGCCTGATCTTATAATGCCTGCATTCAACTCTCCCTGTCTTGAATGCATCTATGCCCTTTACCAGGTTATGTCTAATGATGCCAAATACCTTCTGCTATGCTATTGATTGATAGCCTAG