Transcript asmbl_18053

Sequence
Transcript Sequence for observation asmbl_18053 of TGE0000481:
CCGGTGCGGTGGCAGCCTCGGCCGCCTCGGGTCAGGCGGAAGGTAAAAAGATCACCGATCTGCGGGTCATCGATCTGAAGTCCGAGCTGAAGCGGCGGAACTTAGACATCACCGGAGTCAAGACCGTGCTCATCTCCCGACTCAAGCAGGCTATTGAAGAGGAAGGAGGCGATCCAGATAATATTGAATTAACTGTTTCAACTGATACTCCAAACAAGAAACCAACTAAAGGCAAAGGTAAAAAACATGAAGCAGATGAGTTGAGTGGAGATGCTTCTGTGGAAGATGATGCTTTTATCAAGGACTGTGAATTGGAGAATCAAGAGGCACATGAGCAAGATGGAAATGATGAACTAAAGGACTCTGAAGAATTTGGTGAAAATGAAGAAGAAAATGTGCATTCCAAGGAGTTACTCTCTGCAGAAGAAAACAAGAGAGCTCATGAATTAATAGAGGCAGAAGGAATAGAAGATATAGAAAAAGAGGACATCGAAAGTCAGGAAATTGAAGCTCAAGAAGGTGAAGATGATACCTTTCTAACAGCCCAAGATGGTGAGGAAGAAGAAAATGAGAAAGATATAGCAGGTTCTGGTGATGGTACACAAGAAGTATCTAAACCTCTTCCTTCAGAAGGGAGCCTAGCTGAGGCTGATCACACAGCTCATGAAGAGATGGAAGCTCATACGACTGTGAAAGAAGCTGAGGATGACAACATCTCGGTCACAATCCAGGCTGAAGATGCCATCACTCTGGATTTTGATGGTGATGACCTCCTAGAAACAGGTAAAAATGTGAAAATTACAGATTCTGAAGCAAGTAAGCCAAAAGATGGGCAGGACGCCATTGCACAGAGCCCGGAGAAGGAAAGCAAGGATTATGAGATGAATGCGAACCATAAAGATGGTAAGAAGGAAGACTGCGTGAAGGGTGACCCTGTCGAGAAGGAAGCCAGAGAAAGTTCTAAGAAAGCAGAATCTGGAGACAAAGAAAAGGATACTTTGAAGAAAGGGCCCTCGTCTACTGGGGCCTCTGGTCAAGCAAAGAGCTCTTCAAAGGAATCTAAAGACAGCAAGACATCATCTAAAGATGACAAAGGAAGTACAAGTAGTACTAGTGGTAGCAGTGGAAGCTCAACTAAAAATATCTGGGTTAGTGGACTTTCATCTAATACCAAAGCTGCTGATTTGAAGAACCTCTTTGGCAAATATGGAAAGGTTCTGAGTGCAAAAGTAGTTACAAATGCTCGAAGTCCTGGGGCAAAATGCTATGGCATTGTAACTATGTCTTCAAGCACAGAGGTGTCCAGGTGTATTGCACATCTTCATCGCACTGAGCTGCATGGACAGCTGATTTCTGTTGAAAAAGTAAAAGGTGATCCCTCTAAGAAAGAAATGAAGAAAGAAAATGATGAAAAGAGTAGTTCAAGAAGTTCTGGAGATAAAAAAAATACGAGTGATAGAAGTAGCAAGACACAAGCCTCTGTCAAAAAAGAAGAGAAAAGATCGTCTGAGAAATCTGAAAAAAAAGAAAGCAAGGATACTAAGAAAATAGAAGGTAAAGATGAGAAGAATGATAATGGAGCAAGTGGCCAAACATCAGAATCGATTAAAAAAAGTGAAGAAAAGAAGCGAATAAGTTCCAAGAGTCCAGGACATATGGTAATACTAGACCAAACTAAAGGAGATCATTGTAGACCATCAAGAAGAGGAAGATATGAGAAAATTCATGGAAGAAGTAAGGAAAAGGAGAGAGCTAGTCTAGATAAAAAAAGAGATAAAGACTACAGAAGGAAAGAGATCTTGCCTTTTGAAAAGATGAAGGAACAAAGGTTGAGAGAACATTTAGTTCGTTTTGAAAGGCTGCGACGAGCAATGGAACTTCGAAGACGAAGAGAGATTGCAGAGAGAGAGCGTCGAGAGCGAGAACGCATTAGAATAATTCGTGAACGGGAAGAACGGGAACGCTTACAGAGAGAGAGAGAGCGCCTAGAAATTGAAAGGCAAAAACTAGAGAGAGAGAGAATGGAACGCGAACGCTTGGAAAGGGAACGCATTCGTATTGAACAGGAACGTCGTAAGGAAGCTGAACGGATTGCTCGAGAAAGAGAGGAACTCAGAAGGCAACAACAGCAGCTTCGTTATGAACAAGAAAAAAGGAATTCCTTGAAACGCCCACGTGATGTAGATCATAGGCGAGATGATCCTTACTGGAGCGAGAATAAAAAGTTGTCTCTAGATACAGATGCACGATTTGGCCATGGATCCGACTACTCTCGCCAACAGAACAGATTTAATGACTTTGATCACCGAGAGAGGGGCAGGTTTCCTGAGAGTTCAGCAGTACAGTCTTCATCTTTTGAAAGGCGGGATCGCTTTGTTGGTCAAAGTGAGGGGAAAAAAGCACGACCTACTGCACGAAGGGAAGATCCAAGCTTCGAAAGATATCCCAAAAATTTCAGTGACTCCAGAAGAAATGAGCCTCCACCACCAAGAAATGAACTTAGAGAATCAGACAGGCGAGAAGTACGAGGGGAGCGAGACGAAAGGAGAACGGTGATTATTCATGACAGGCCTGATATCACTCATCCTAGACATCCTCGAGAGGCAGGGCCCAATCCTTCCAGACCCACCAGCTGGAAAAGTGAAGGAAGCATGTCCACTGACAAACGGGAAACAAGAGTTGAAAGGCCAGAACGATCTGGGAGAGAAGTATCAGGGCACAGTGTGAGAGGCGCTCCCCCTGGGAATCGTAGCAGCGCTTCGGGGTACGGGAGCAGAGAGGGAGACAGAGGAGTCATCACAGACCGAGGAGGTGGATCACAGCACTATCCTGAGGAGCGACATGTGGTTGAACGCCATGGACGGGACACAAGCGGACCAAGGAAAGAGTGGCATGGTCCACCCTCTCAAGGGCCTAGCTATCATGATACGAGGCGAATGGGTGACGGCCGGGCAGGAGCAGGCATGATAACCCAACATTCAAGTAACGCATCCCCAATTAATAGAATTGTACAAATCAGTGGCAATTCCATGCCAAGAGGAAGTGGCTCCGGATTTAAGCCATTTAAGGGTGGACCTCCGCGACGATTCTGAAAATGAGCTCTCTGCCAAGGTTTTAAGATAATTTATTGAAATCTCCTGTAAACTTTACTTGACTACTTATGAAGAGGACCTCTGACTTGCTTGAGAGTTCTGTCAGACTTTTCTTTTTAAAAATTTAACATGATTGCTTTTCTCAATTTTGGAGAAGATGTTTAAATAGTTCTGTTGTAACTTTTAATAGTTTTGTGTATCATTCAACTTTTTTTCTTGCAGCACCGAGGCACATTTGAAAAGATGGAATTGAAGTCGTTTTGTTTAACGCTGTGTGAATATAAAGAGTAGTTTGCAGCTGTGTGGTAGTGGTTTAATTTGCAGCCTTAGCTCTGTGGTGTCTGGCTCTAGAGTTACTTCTTTTTACCAAGCATTTTCAGCCTCCATTTTGAAGGCTGTCTACACTTAAGAAGTCTTAGCTGTCTAATTTTTAGAGAATAAGATTGTTCATTGCATTTCTGAGTATTATGTAACCTATTTTTGCAGAAGGTACTGTTACATTAAGTGCATCTGTGTATCCTGGTTTAAAAAAATGTAATCTTTTTTGAAATAAACCTTCATATTCTGTATAGTTGCTAAAGTGTTGAGAACCTTTTTAATTGTAAAATGAGAACCGATTTTCAGTTTAGTGTAGCAGCACACTTGTTCAGGTTTGCATGGTATGAAACCAAATAGATTCATGAAACCTTGGCCATGAGGTTTGTTTCACAAGGTTCTTAGACCGAGTTGTGCAGGTAAGTGCACTTTTAGGTAATCTGCACTGTTTGTTTGATGGATAAATTCCATCTCTGGGAATTGTGTGGGTATTAATGTTTCCATGTTCCCAACTATGTTGAGAAGTGGAAAAAAACCCAGGTTCTAGATGGGTGAATCAGTTGGGTTTTGTAAATACTTGTATGTGGGGAAGACATTGTTGTCTTTTTGTGAAAATAAAAATCCACACCTGG