Transcript asmbl_12953

Sequence
Transcript Sequence for observation asmbl_12953 of TGE0031951:
ACGCCTGCGGGTGCCGCGTCCTTCGCTGCATCCCGGGGTGACGGGCTCAGGCTCCGCCTGCTGCCGCTGCACTCTCGGAGCTAAAAGATACCTACTCACAGATAACATTGTGAAGTTAAAGGAATTTCAACATAAGAAGATAGCTATTGCATATAACCTACCTGGCACCAAAGAAATCTATTTCAGAAACTTGGAAGAGAAGTTGACCCAGAACAAACTCATCTTGAAGGAAGAGTTGAAAACGCTGCTGTACCTGTGCCAGTCCCTGGAAGATGTGCAGCTGGCGAAAGCCGTCATTTATAGGTACCATGCAGAAAACAAGAATTTCACTTTGGGGGAATACAAGTTCGGACCAGTTTTCATGAGGCTGTGCTACGAGCTGGACCTGGAGGACTCTGCAGTGGAGCTCGTCAGAGACAAGCATCTACAAGGCTTCTTCCTAGATTCAACGTCATTCAATATTTTGATGGATATGTTATTTACCAAAGGCAAATATGAACGTGCACTTCAAGTGTTGATCGAAATGAAAAACCAAGATGTGAGGTTCAGCAAAGAAACCTACATCCTCGCTTTTGCAATCTGCTACAAACTGAATACCCTGGAATCGCTTAAAATCTGTACTACGTTAAGAGAAGAAGCCCTAATTAAGGGAGACATTATCTGCAGGAGAGCATACTGTTTTGTAGTGGCATTAGCTCTGAATAAGAACCAGTTGAAAAACGCTGTGTCCATTTTTTCTCAAATCGTGAATCCAGAAAGCATAGTGTGTATTAACTTAAATATCTTGATCCACATCCAGTCAAATATGTTGGAAAGCCTGTTAAAGATCTTAGAGGACTCTCTTGACACAAATTTATCGAAATTTGTAAGAAGACACACATTCTCAGAGGAAGTGCTGGCCAAAGTGAGGGAAAAACTGAAGGACAGCCCTGCACTCATAGCCAGATTCGATGAGGTCTATGGGAAGCTGCACGTGAACGGTCAAATCACCGTTCATTCTTTGGATGCTCTGCTCTGCCACGTCCCCCGGGACAAGAGATCCAACTTGTTGCTGTTAAAGAAGAGGGCAGTCAGCCACCGGACCTTACAGCCTCTCAGCCGGTCCCTGCTGACCGAGTAACTGCTTTCCATTTCCCTGGTCTGGAGCAGCTGCTGCTACAGTGGATTACTGGCTGCTCCGGGCCGGGCATCTTACTTACTTCAGTGGCCCTGTGCTGACGCTTGGTCTCCCTAAGTCCTAAGTCCCCCGAGTGGTGACATGCTACCAGAGAAATGGGAAGAGCTAGCTCGAGCCAAGGGAGCCCCACAGAAAGGCAGCTGCCCTCGTTTCACAGGCTCCAGAGTAAGACTCAGAGCTGCTAATGCAGCCCAGTAGAGTGGAGCTCAGGAGGTACCCACAGACGGGATTTCTCTTGGTCTTGACTGACCTTTCACGGCAGAGGTGACTCGCAAGTTGGTGGGGAGACCTGAAACCCTCATCTCCCATCTTTGGAAGTGGCGGAGGCCTTCCTCGTCTCCGCCATCGTTATTCCATCTGTGAGGCGATGCTGCCTGGGTGTGCTTGGATGACTTCACATTTCCATTCAAGGTTCAGTAGAGTTCAGCTTTCTCCAGAATAAGAAATAAAAGGTTCCTGTGCAGA