Transcript asmbl_12856

Sequence
Transcript Sequence for observation asmbl_12856 of TGE0031937:
AAAAAGTTCCACAAGTACTCCCCGCCGACTGCTGTGCGCCTGCGCCGGCACTTGGTACGACGCGTGGGGTCAAGGGTCACCGGCAAGATGGCGGCGGTGCTGACCTTCCGCCGGCTGTTGACTCTCCCCAGGGCTGCACGGGGTTTCGGGGTTCAAGTGTCGCCGAGCGGGGAAAAGATCACGCATACCGGCCAGGTGTATGATGAAAAAGACTACAGGAGGGTTCGTTTTGTAGATCGTCAGAAAGAGGTGAATGAGAACTTTGCCATTGATTTGATAGCACAACAGCCTGTGAATGAGGTGGAGCACCGCATCATAGCCTGCGATGGAGGCGGTGGTGCCCTGGGCCACCCCAAGGTGTACATAAACTTGGACAAAGAAACAAAAACGGGGACATGTGGCTACTGCGGCCTGCAGTTCAAGCAGCACCATCACTAGTGTGGGCTGTGTCCTGGTCCTCTGACTCCTATGGAACATCTCCACGCTGGGTGTTCTGTGTGAGGCCACTGCTCTGTGAATGGTGTCCCTTGTTTTGAATAAAGGATGCTCCCACCATG