Transcript asmbl_12658

Sequence
Transcript Sequence for observation asmbl_12658 of TGE0031913:
CCGCCCCTTCCCGGTCTTGCCCTGCAGTTTCTGCTGGGCCTAAGCCTCCGGGCTCAGTTTGACCACAGTATCTAGCTATGGCGGCAGTGACCTGGAGTCGGGCTCGATGCTGGTGTCCGAGGTAAGCTTGCAGCCTCGACTCTCCGGCCCAAAGTCGCCAGCGGGAATTTTCGCCCGCCCACGGAGCCGCCCGCTTTGTCATCTGGCCTGGCTAGCGAGACAGCAGGATATTACTTTGACGATTTCCCAGCGAGAGAGCTCTAAAGAGTGACCTCGAAGGTTCTTCCTCTGCTGAGTCCCAAAGGTGTCCTGCAGGTCTTCAGATTACAAGTGGCTAAACTGCACTTGGGCAGACCAACAATGAGAGCCAGTCAGCAGGACTTTGAAAATGCATTGAACCAGGTGAAACTCTTGAAGAAGGACCCGGGAAACGAAGTGAAGCTAAGACTCTATGCACTGTACAAGCAGGCCACAGAAGGACCCTGTAATATGCCTAAGCCTGGTATGCTTGACTTTGTCAACAAAGCCAAGTGGGATGCATGGAATGCCCTGGGCAGCCTACCCAAGGAAACTGCCAGGCAGAACTATGTGGATCTCGTATCCAGTTTGAGTTCCTCATCTGAAGCCCCGAGCCAGGGAAAGCGTGGAGCTGATGAGAAAGCCCGGGAGTCCAAAGACATCCTGGTAACTTCTGAAGATGGTATCACGAAGATCACGTTCAATCGGCCCACCAAAAAGAATGCCATATCCTTCCAGATGTATCGGGATATTATACTCGCACTTAAAAATGCCAGCACTGATAACACTGTCATGGCTGTTTTCACAGGAACTGGTGACTACTACTGCAGTGGGAATGACCTGACTAACTTCACTAGTGCCACTGGGGGGATAGAGGAGGCAGCTAGCAACGGTGCTGTGTTACTGAGGGACTTTGTAAACAGTTTTATAGACTTTCCCAAGCCTCTGGTTGCGGTAGTAAATGGCCCAGCTGTGGGAATCTCTGTCACCCTTCTGGGACTATTTGATGCTGTCTTTGCATCAGACAGGGCAACGTTTCATACTCCATTCAGCCAACTCGGCCAGAGCCCGGAAGCATGCTCCTCTTACACGTTTCCGAAGATGATGGGCTCAGCAAAGGCAGCTGAGATGCTTCTCTTTGGGAAGAAGCTGACAGCAAGAGAGGCCTGGGCTCAAGGCCTTGTCACTGAAGTTTTCCCTGAGAGCACTTTTGAGACAGAAGTCTGGACCAGGCTGAAAACATATGCGAAGCTCCCGCCAAACGCCATGAGAATTTCCAAAGAGTTAATCAGAAAAAATGAGAAAGAAAAGCTCTACGCAGTCAACGCTGAAGAGTGCACTACTCTGCAAGCAAGGTGGCTGTCAGAGGAGTGCATGAACGCAATCATGAGCTTCGTCTCCAGAAAACCAAAGCTGTGAAGACCACCACAGCAGCTAGACTCCTCATAGGGAGCATGGGCTGGGAGGTCCAGTTTCGAGGACTCAAACGACACATGCTTCTCTGTGCCTTTTCCTTGATTAACGTAGCAATTATGATGAGAATTCTTCACAGTACTGATAAATAAAACTTTTCATAAATCAA