Transcript asmbl_11571

Sequence
Transcript Sequence for observation asmbl_11571 of TGE0031867:
CTCCGCTGTCCGCAGTCGGCCGCGGGTTAGCGGGCAGAGCGTCTCCTGTCGCCGGTTCCCCTCGCTCACTGCTCTCTCGTGCCGGAGGCCGCTCCTCTCGGCTCTCGCTCTCTCTCTTTCTATCTCTCTCCCTTCCGTGGATCCGCCATGTCGGAGCCGGGCGGCGGCGAGGACGGCTCGGCCGGCCTGGAGGTGTCGGCGGTGCAGAATGTGGCGGACGTGGCGGTGCTGCAGAAGCACCTGCGTAAGCTGGTGCCGCTGCTGCTGGAGGACGGCGGCGACGCGCCGGCTGCGCTGGAGGCGGCGCTGGAGGAGAAGAGCGCCCTGGAGCAGATGCGCAAGTTCCTGTCAGACCCGCAGGTCCACACGGTCCTGGTGGAGCGCTCCACCCTCAAAGAGGATGTTGGTGATGAAGGAGAAGAGGAGAAAGAATTCATTTCCTATAACATCAACATAGACATTCATTACGGGGTAAAGTCCAACAGCTTGGCGTTCATCAAGCGAGCTCCTGTGATTGATGCAGACAAGCCAGTGTCGTCCCAGCTCCGAGTCCTCACTCTGAGTGAAGACTCGCCGTATGAGACACTGCACTCTTTCATCAGCAATGCAGTGGCTCCTTTCTTTAAGTCCTACATCAGAGAGTCTGGCAAAGCAGACAGGGATGGTGATAAGATGGCTCCTTCAGTTGAAAAAAAGATTGCAGAGCTTGAAATGGGACTCCTCCACCTGCAGCAGAACATTGAGATCCCAGAGATCAGCTTGCCAATTCATCCCATCATCACGAACGTTGCGAAGCAGTGCTATGAGCGCGGAGAAAAGCCCAAAGTTACAGACTTTGGTGATAAGGTTGAAGACCCAACTTTCCTTAACCAATTACAGTCTGGAGTTAATCGGTGGATCCGAGAAATTCAAAAGGTGACCAAGCTTGACCGGGATCCAGCATCAGGAACTGCCTTGCAGGAAATCAGCTTTTGGCTAAACTTGGAACGTGCGTTGTACCGCATCCAAGAGAAGCGGGAGAGCCCCGAGGTGCTCCTGACTCTGGACATCCTGAAGCACGGCAAACGTTTCCATGCCACTGTCAGTTTTGACACTGATACAGGTCTGAAGCAGGCGTTGGAAACGGTGAATGACTACAACCCTCTGATGAAAGACTTCCCTCTGAATGACTTGCTGTCTGCCACGGAGCTGGACAAGATAAGGCAGGCCCTTGTTGCAATTTTCACACATCTGAGAAAGATCCGCAACACGAAGTACCCGATTCAGCGGGCCCTGCGTCTCGTGGAGGCCATCTCCAGAGACCTGAGTTCTCAGCTGCTCAAGGTCTTGGGCACTCGGAAGTTGATGCATGTAGCCTATGAAGAGTTTGAAAAGGTCATGGTGGCTTGCTTCGAAGTCTTCCAGACGTGGGACGACGAGTACGAGAAGCTCCAGGTGCTGCTGCGAGACATCGTCAAGAGGAAGCGGGAGGAGAACCTGAAGATGGTGTGGCGCATCAACCCCGCTCACAGGAAGCTTCAGGCCCGCCTCGACCAGATGAGGAAGTTCCGCCGCCAGCACGAGCAGCTGAGGGCTGTCATTGTCAGGGTCCTGAGGCCACAGGTCACAGCAGTCGCACAACAGAACCAAGGAGAAGCACCTGAACCCCAAGACATGAAAGTGGCCGAGGTGCTCTTTGATGCTGCCGACGCCAACGCCATTGAGGAGGTGAACCTGGCCTACGAGAATGTCAAGGAAGTCGATGGTCTGGATGTTTCCAAAGAAGGGACGGAAGCCTGGGAGGCCGCGATGAAGAGATACGATGAGAGGATCGACCGTGTGGAGACCCGCATCACCGCCCGCCTCCGAGATCAGCTCGGCACGGCCAAGAATGCCAATGAGATGTTCAGGATTTTCTCCAGGTTCAATGCACTGTTCGTCCGCCCACACATCCGAGGGGCCATTCGTGAATACCAGACCCAGCTGATCCAACGTGTGAAAGATGACATCGAATCTCTGCACGACAAGTTCAAGGTCCAGTACCCGCAAAGCCAAGCTTGTAAAATGAGTCATGTCCGTGACCTGCCCCCCGTGTCAGGGTCTATCATCTGGGCTAAACAGATCGACAGACAGCTCACTGCCTACATGAAGCGAGTGGAGGATGTCCTGGGCAAAGGCTGGGAGAACCACGTGGAAGGGCAGAAGCTGAAGCAGGATGGAGACAGCTTCCGAATGAAGCTCAACACCCAGGAGATCTTCGATGACTGGGCGAGGAAGGTTCAGCAGCGCAACCTTGGTGTCTCCGGGCGCATCTTCACCATTGAGAGCGCTCGCGTGCGGGGCCGCACTGGGAATGTCCTCAAGCTAAAGGTGAACTTCCTTCCAGAGATCATAACACTCTCCAAAGAAGTCCGGAACCTCAAGTGGCTTGGCTTCCGAGTGCCACTTGCAATTGTGAACAAGGCTCACCAAGCCAACCAGCTCTACCCATTTGCCATCTCGCTGATTGAAAGCGTCCGGACTTACGAGCGCACCTGTGAGAAGGTGGAGGAGCGCAATACCATTTCCCTGCTAGTGGCCGGCCTAAAGAAGGAGGTGCAGGCCTTAATCGCAGAAGGCATCGCGTTGGTGTGGGAGTCCTACAAGCTCGACCCCTACGTGCAGCGCCTGGCAGAGACGGTTTTCAACTTCCAGGAGAAGGTGGACGACCTACTGATTATTGAGGAAAAGATAGACCTGGAGGTCCGCTCCTTGGAAACCTGCATGTATGACCACAAGACATTCTCAGAGATCTTGAACAGAGTGCAGAAAGCAGTGGACGACCTAAACCTGCACTCCTATTCCAATCTGCCCATCTGGGTCAACAAGCTGGACATGGAGATTGAAAGGATACTGGGCGTCCGCCTGCAAGCTGGCCTTCGAGCTTGGACCCAGGTTCTTCTTGGACAAGCTGAGGATAAAGCAGAAGTCGACATGGATACAGATGCTCCACAAGTCAGTCACAAGCCTGGTGGAGAGCCCAAGATCAAAAACGTGGTTCACGAGCTGAGGATAACAAATCAGGTCATCTATCTGAACCCACCCATTGAGGAGTGCAGGTACAAGCTGTACCAGGAGATGTTCGCGTGGAAGATGGTTGTGCTGTCCCTGCCCAGGATCCAGAGCCAGAGGTACCAGGTGGGAGTGCATTACGAGTTGACGGAGGAAGAGAAGTTCTATCGGAATGCACTGACAAGGATGCCCGACGGCCCTGTCGCCCTGGAAGAGTCCTACTCTGCGGTCATGGGCATAGTGACTGAAGTTGAGCAGTATGTTAAGGTTTGGCTTCAGTACCAGTGTTTGTGGGATATGCAGGCAGAAAACATTTACAACAGGCTAGGGGAAGATCTCAACAAGTGGCAAGCTCTCCTGGTCCAGATAAGGAAAGCCAGAGGAACCTTTGACAATGCGGAAACCAAGAAAGAGTTTGGTCCGGTGGTGATAGATTACGGCAAGGTCCAGTCCAAGGTGAACTTGAAGTATGACTCCTGGCATAAGGAGGTTCTCAGCAAGTTTGGGCAGATGCTGGGCTCAAACATGACAGAATTCCACTCCCAGATCTCAAAGTCTCGCCAAGAGCTGGAGCAGCACTCCGTTGACACAGCCAGTACCTCTGACGCGGTGACCTTCATCACCTATGTGCAATCTCTGAAACGGAAGATCAAACAGTTTGAGAAGCAAGTTGAACTCTACCGCAATGGTCAGCGTCTGCTGGAAAAACAAAGGTTCCAGTTCCCGCCTTCTTGGCTTTACATTGACAACATCGAGGGTGAGTGGGGGGCCTTCAATGACATCATGCGGCGGAAGGACTCTGCCATTCAGCAACAGGTGGCAAACCTGCAAATGAAGATCGTACAGGAGGACAGAGCTGTGGAAAGCCGGACCACGGATCTGTTGACAGACTGGGAGAAGACCAAACCTGTCACAGGCAATCTGCGTCCTGAGGAGGCTCTTCAGGCCCTCACCATATATGAAGGGAAGTTCGGCCGGCTGAAGGACGACAGAGAGAAATGT