Transcript asmbl_10905

Sequence
Transcript Sequence for observation asmbl_10905 of TGE0000454:
GACCTATCGGCCAGGTCCTTATATTGCCGCCATTTTTTTAGAAAGGCTTAAAAAAAAGACGACTGGTGTCGCTGTTGTATTCCCCATCACTTTAGCCGCCTGTCAGTTAATTAGAGTACAGAAGGCAGAATCCCGAAACGAACTCTTCTTCCTAAAGCGGAGAAAGAGTCTCTTACCCATCCCGGCGCCCTTAACCAAGATGGCTGAAACAGCGTCAGTATCCACTCTAGAAACCAGAAACGTGTGTCTCTCTATGGTCTGAAAGATTCCTTTTGCGTCGCGCTTTCGACGACTTCCGGCGGCGGCTCTCGCGGGATTGGCTGTTGGCGGCGTTGCGGCTGAGCTCGTGTGCGGCAGCAGAGGTGTTAGCGGCGGCTGCAGCAAGAGCGTTTGGCGCGATGTCTCACACCATTTTGCTGGTACAGCCTACCAAGAGGCCAGAGGGCAGGACTTATGCTGACTATGAGTCTGTGAATGAGTGCATGGAAGGTGTTTGTAAAATGTATGAAGAACATCTGAAGAGGATGAATCCCAACAGCCCTTCCATCACATACGATATCAGCCAGTTGTTTGATTTTATTGACGATCTGGCAGACCTCAGCTGTCTGGTTTACCGAGCTGATACACAGACATACCAGCCGTATAACAAAGACTGGATCAAAGAGAAGATCTACGTGCTCCTCCGTCGGCAGGCCCAACAGGCTGGGAAGTAATTGAGTCGGAAGCATTGGGGCTGGGGGTGGACTTGGAACAGGTACATACAGCGTGCTGTAGTGAACCTTTTGTATGATAGCGATCCTGTTTCAACGTTGTTACACTCAAGCCAAGATTGAATGTCTGACATGAACCGTGAATGATCTTGTCACTCTGAAGCCACCGTGGCCCTTTGCTCCTTTACTTTCATTTTTTTACTTAAACATTTTTATGATAATACAAATAGAAAACATTTTTGCCATTTAAGGTTGGTTCCGGTCCTTGAAACTGTCGAGTCTGCTTTTAAGCAGTGAGCGCACTAACCCTTTGTGGGGGTGGGGTGGGGACAAGGTTAGTCATATAGCCTCTGGGAAAGTCTCAGTGAAAAATAAAGAAATGTTCTGTAGTTGT