Transcript asmbl_18028

Sequence
Transcript Sequence for observation asmbl_18028 of TGE0000479:
TGTGGGGCCAGGCGGAAAATACCCGCCAACGACCCAAAAAAGGCCGGCGGCGGGTGGACGCGGCGCGCGAGGACCCGAGCCAGGCGGGGACAGGACGGCGGGGCGAGCCAGACAAAAAGTAACCTTCCTGAAGAGGACATGTGATTGGAAGTTGTCAATTGTTGAAGCATTGGTAACTCCAGTCTCTAACGTTTTAGAAAATCATAACAAGCGGTTCTCTACCCTGTAAAGGTGAACTACTGAGTTCTTCATTATGTCTGATGGAGATTATGATTACCTCATCAAGTTTTTAGCTTTGGGAGACTCTGGTGTAGGGAAGACCAGTGTACTTTACCAATATACAGATGGTAAATTTAACTCCAAATTTATCACAACAGTGGGCATTGATTTCAGGGAAAAAAGAGTGGTGTACAGAGCCAGTGGGCCGGATGGAGCCACTGGCAGAGGCCAGAGAATCCACCTGCAGTTATGGGACACAGCAGGGCAGGAGAGGTTTCGTAGCTTAACGACAGCGTTCTTCAGAGATGCTATGGGTTTTCTTCTACTTTTTGATCTGACAAATGAGCAAAGTTTCCTCAATGTCAGAAACTGGATAAGCCAGCTACAGATGCATGCATATTGTGAAAACCCAGATATAGTGCTGTGTGGAAACAAGAGTGATCTGGAGGACCAGAGAGTAGTGAAAGAGGAGGAAGCCATAGCACTCGCAGAGAAATATGGAATCCCCTACTTTGAAACTAGTGCTGCCAATGGGACAAACATAAGCCAAGCAATTGAGATGCTTCTGGACCTGATAATGAAGCGAATGGAACGGTGTGTGGACAAGTCCTGGATTCCTGAAGGAGTGGTGCGATCAAATGGTCATGCCTCTACGGATCAGTTAAGTGAAGAAAAGGAGAAAGGGGCATGTGGCTGTTGAGAAGTCAAGTAAGCGACATAGTAGTTCAGGTGGCCCATGCCTGGGATCTTCTCTATGATTGATACATGGCACAGTGAGAGATTAATGGGCATTGTGTACAAATTGCTTCTCACCATCCCCATTAGACCTACGAATAAAGCATCCGGTTCTAAAATTAATTTGTTGCAGCTTTGTAAATATTTCTTTAAGATTCAGCCTGAGAGTTAGGAGAAATATTTCAGAGCCAAAAGTGCCTTATACAACCTTAGCCTATTATAGTAAATCATTCAAGGATTCAGAATTTTGCAGTCACAGAAGAGTGTATTTATTATGTAGAATGAATGAGGGTACTGTCACCTGCCTTAATGTAGGTAGGCCCAGAGTCTTACATTTAAGATCTTACATGCAGTTATAAAACCGCCACAGTCTTCAATCCAGATTTGAAGACTCATGCCATAGGTGACATTCTAAAATACCATTAAAGCCACTTAAATGTTAAATAAGAATATACATGCACATCAGCTCAATGTCTTTGAGTATTAATTTTATGTAAG