Transcript asmbl_10670

Sequence
Transcript Sequence for observation asmbl_10670 of TGE0031764:
AGGTTGGCTAGTCTGTCTGAGAAACCACCTGCGATTGACTGGGCTTACTACAGGGCCAATGTGGCCAAGCCTGGCTTGGTGGATGATTTTGAAAAGAAGTATAATGCCCTGAAGATTCCTGTGCCTGAGGATAAATACACAGCCCTGGTGGACCAGGAGGAGAAGGAGGATGTGAAGAGCTGTGCTGAGTTTGTGTCTGGATCCCAGCTCAGGATCCAGGAGTATGAGAAGCAGCTGGAGAAAATGAGGAACATAATTCCCTTTGACCAGATGACCATTGATGACTTGAATGAGATCTTCCCAGAAACCAAGCTGGACAAAAAGAAGTACCCGTACTGGCCCCACCAGCCCATCGAGAACCTGTGAAGCAGCCTGGGACGGAGCCCCGGCCGACATGAAATAAAACATTTAAATAGTGCTGGCTAT