Transcript asmbl_10638

Sequence
Transcript Sequence for observation asmbl_10638 of TGE0031758:
GGGGGTTGAGGGTGAGGACTATAGAAGGCTCTGAGCACTGGGCTCAGGGTTCATCTGGACAGAGTAAGCAAGCTCATCAGGCCGGTCCTGGGGCGGCGAGTCCTGAGCTGGGCAGGTAGGGCTCCTTCCTCAGCTGTGCCACCAGCTGTGGCTTCTGGCCCCAGATCCGGGTAAACTCCGTAAACCCCACTGTGGTGCTGACTGACATGGGCAAGAAAGTCTCTGCAGACCCTGAGTTTGCCAGGAAGCTCAAGGAGCGCCACCCACTGAGGAAGTTCGCAGAGGTTGAAGACGTCGTCAACAGCATCCTCTTCCTGCTCAGCGACAGAAGTGCCTCTACCAGTGGCGGTGGCATCCTGGTGGATGCTGGCTACCTGGCCTCCTAGTCTGCTCAGTTGCCGCGGACATCTGAGTGGCCTTCTTAGCCCCACCCTCAGCCAAAGCATTTACTGATCTCGTGACTCCGCCCTCATGCTACAGCCACGCCCACCACGCAGCTCACAGTTCCACCCCCATGTTACTGTCGATCCCACAACCACTCCAGGCGCAGACCTTGTTCTCTTTGTCCACTTTGTTGGGCTCATTTGCCTAAATAAACGGGCCACCGCGTTACCTTTAA