Transcript asmbl_10608

Sequence
Transcript Sequence for observation asmbl_10608 of TGE0031751:
CCGGAAGTGACCGTCCGAGCGGCGGGCGGCGGACGACGTTCGTCATTTGGTGCGGGAGGGAGCGCGAGAGCGGCGGTCGAGCCTCCGGTGTCCCAAGCTAGAGGTAAGCATGGCAGAACAGGAACCCACTGCTGAGCAGCTTGCGCAGATAGCTGCAGAGAATGAGGAAGATGAGCACTCTGTGAACTACAAGCCTCCAGCCCAGAAGAGCATCCAGGAGATCCAGGAACTGGACAAGGACGATGAAAGCCTCCGAAAGTACAAGGAGGCCCTGCTGGGCCGAGTAGCTGTCTCTGCAGACCCCAACGTCCCCAATGTCATTGTGACTCGACTGACCTTGGTATGCAGCACTGCCCCAGGCCCTCTGGAACTGGACCTGACAGGTGATCTGGAGAGCTTCAAGAAACAGTCGTTTGTCTTGAAGGAAGGTGTGGAGTACCGGATAAAAATCTCTTTCCGGGTGAACAGAGAGATCGTGTCCGGCATGAAGTACATCCAACACACATACAGGAAAGGGGTCAAAATTGACAAGACTGACTACATGGTCGGGAGCTATGGGCCGAGGGCCGAGGAGTATGAGTTCCTGACACCCATGGAGGAGGCTCCCAAAGGCATGCTTGCTCGGGGCAGTTACAACATCAAGTCGCGCTTCACAGATGACGACAAGACTGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAAAAGGAGTGGAAGGACTGAGCTCCAGCTGGGAGACGGGCAGGGCGACGGACAGACAGAAGGACCGACATGCCCCACCCTAACCCCCTACCTACCCCAAACCAAAGTGCTGACAGGACCTCCCTCACCCGTCATTCCTCCCTAGTCCACTCAGGCAGTCAGCTCTCCTGTCTGCCCCTCCTCCACCTCCTGCCCGCAGGCCCCTGTGGTCTCCAGTGTCACATTGCTGCTTCTGCCTGTGCAGTGGGGGAGGGGTTCCAGCCCAGGCCTCCAATCTGCTGTGTCCCTCCAGGTTCCCTCTGTCTTCCCTTCCTCAGGCCCTGGCTTCTAGAATGGAACAGAACACTGTCAGGGTTGTCCAGCCCACCTTGTCTCTGTCGCAGCATGGGGAAGGGCTGGGCTATCTGTCCTCTAGTCCCACCACTCCCTGGCCAGGTCATCCATCACTGTCAGTCACTGTCTAACCATGATGCCTTAACATGTGGAACGTGTGCTGGGGGCCGTCGCTAACTCTTAACTCCCTGTCTGCATGAGCATGTGCTCTCCCTGTCCTCGCCTCGTCTGCCATCCCCATCCCAGTGACCCACCCAAGGGAGGCCTGGGGTGCGCTGCTGTTGCTTCCTGCGAGCCTGGCCAGCTCTTCCCCTCCCCGTGGCCAGGGTTGGGGGTGGCTCCAGTAGCTAGGGGAGGGTCAATTGCCAAAACTCGATGCCTCCAGCCCCATCTAGGAGGCAGGGTAGGGTGCCTCATTCCTCTGCCTTCTCTGTCCCTTGTAGGCAGTACTCGGAGCCCCTGTCCCCACAGAGAGCCCCTGAGGGACAAAGCCAGCCGAGCCTTACTTGTCTCACCTGGGCCACGTGGCCTGAACCTCGTGCCTGGCCTGTCAGTATTTATTGCCTCCATTTGGGCCAGCTGGCCTGATGCCTCTGCCCTGGTTCTTGGTGCCACCATCCCTGGGCCGACCCTCCCTGGACCCAGCCAGGACAAATGTGGGACCAAGTTCACACAGTTGGGAGCTGTCTCCTGTGCCTCCCCTCCCTATCCCCAGTCCCTGTGTGGTGTCTGCCAGGCCCAGCCTCAACAGGCAGAGGAGCCTGTCCCTGCTTCTCTTCTGACTGGGAAATAAACACCCCTGAAGGAGTCTG