Transcript asmbl_10584

Sequence
Transcript Sequence for observation asmbl_10584 of TGE0031747:
CGGCGCGCGCCTTACATCCGGTTCCCGCCGCGGCTTGCAGTTGTCTTTCTGCGGAATCCGGATCATGGCGGCTAACGCCACGATGGCGACGTCTGGCTCGGCGCGGAAGCGGCTGCTCAAAGAGGAGGACATGACCAAAGTGGAGTTCGAGACGAGCGAGGAGGTGGACGTGACCCCCACGTTCGACACCATGGGCCTGCGAGAGGACCTGCTGCGCGGCATCTACGCCTACGGTTTTGAAAAACCTTCAGCGATTCAGCAGCGTGCTATCAAGCAGATAATTAAAGGGAGAGATGTCATTGCACAGTCTCAGTCTGGCACAGGCAAGACGGCCACCTTCAGTGTCTCAGTGCTGCAGTGCTTGGATATCCAGGTTCGAGAAACCCAAGCTTTGATCCTGGCTCCAACCAGGGAGTTAGCGGTGCAGATTCAGAAGGGTCTGCTCGCGCTGGGGGATTACATGAACGTGCAGTGCCATGCCTGCATTGGGGGCACCAACGTCGGCGAGGACATCCGGAAGCTGGACTACGGACAGCACGTGGTGGCAGGCACGCCGGGACGCGTCTTTGATATGATCCGCCGGAGAAGTTTACGGACACGGGCTATCAAGATGCTGGTTTTGGATGAGGCTGATGAAATGTTGAACAAAGGTTTCAAGGAGCAGATCTATGATGTGTACAGGTACTTGCCACCAGCCACACAGGTCGTCCTCATCAGCGCCACACTGCCTCATGAGATCCTGGAGATGACCAACAAGTTCATGACCGACCCCATCCGCATCTTGGTGAAGCGTGATGAGTTGACTCTGGAAGGCATCAAACAGTTCTTTGTGGCTGTGGAAAGAGAGGAATGGAAATTTGATACTCTATGTGATCTCTATGACACGCTGACCATCACCCAGGCCGTCATCTTCTGCAACACCAAGCGGAAGGTTGACTGGCTGACAGAGAAAATGAGAGAAGCCAATTTCACTGTGTCGTCCATGCATGGAGACATGCCCCAGAAAGAACGAGAGTCTATCATGAAGGAGTTCCGGTCAGGTGCCAGCCGGGTGCTCATCTCCACAGACGTCTGGGCCCGGGGCCTGGATGTCCCTCAGGTGTCCCTCATCATTAACTACGACCTGCCCAACAACAGAGAACTGTACATTCACAGAATTGGGAGATCGGGTCGGTATGGACGAAAAGGTGTGGCCATCAATTTTGTGAAGAATGATGACATCCGGATTCTCAGGGACATTGAGCAGTACTACTCCACCCAGATAGACGAGATGCCCATGAATGTGGCTGACCTCATCTGAAGCTGGTGCTGGTGCACCGAGGCCCTGTTTGGAAACGGAAGCTTCTATTTAATGGGGTTGATATGGACTGTCTTCTCGGAGCCCCTCGGGAAGACCCTCAGCCTCCGCCATCTTTTCTAATGCACATGTACATAATCCGATGCTTAACCTTTTACATTAAACGTGGACATTTTCCTGTGA