Transcript asmbl_10411

Sequence
Transcript Sequence for observation asmbl_10411 of TGE0031725:
GTCGAACTCGGTCGAGCCGACGGGAGGAGGAGGGGGCAGACACTAGCGAGCGGGGAAGGAGGGGTGGAAGAGGGAGGGACGTTAAAACGGCTTCTCGACGCTGATTGGACAGCAGAGGAGCACTTCCTCGCAGCACGCGCTGAGGCGGCAGTTTGCGGGCTCCAGATACCATTCCCCGCGGTCAAGATCCCGCTTACGGGTTCTCAGATCGGCGGGCAGGGCAGCCAGGTCACCCAGCAGCCCGGCCGATCTCCCCGGGGGCGTTGGAGCCGCGCTTCCGCTCCGGCCCTCGACACCACCGGCCCCTCCGCTGGTGACGCCCCCGCAGAGGCTTCGCCGTCGCCGAGGCCTTCTCTCCGCGACTCGTCGCCGCAGGATTCTACTTTCACTGGGTTCCGCCCGCACACCGCCACCATTGACGCCATGTCGAGTTATTCTAGTGACCGAGACCGCGGCCGGGATCGAGGGTTTGGTGCACCTCGATTTGGAGGGAGTAGAACAGGACCCCTCTCTGGAAAGAAGTTTGGAAATCCTGGGGAGAAACTAGTTAAAAAGAAGTGGAATCTTGATGAGCTGCCCAAATTTGAGAAGAATTTTTATCAAGAACACCCTGATTTGGCAAGGCGCACCGCACAAGAGGTAGATACATACAGAAGAAGCAAGGAAATTACAGTTAGAGGTCACAACTGTCCAAAACCTGTTCTGAATTTTTATGAAGCAAACTTTCCTGCGAATGTCATGGATGTGATTGCAAGGCAGAACTTTACTGAACCCACTGCTATTCAAGCTCAGGGCTGGCCAGTTGCTCTCAGTGGATTGGATATGGTTGGAGTAGCTCAGACTGGATCTGGGAAAACATTATCTTATTTGCTGCCTGCCATTGTACACATAAACCACCAGCCATTCCTAGAGAGAGGTGATGGGCCTATTTGCTTGGTGCTGGCACCAACTCGAGAACTGGCACAGCAGGTGCAGCAAGTGGCTGCTGAATATTGTCGAGCTTGTCGCTTGAAGTCTACTTGCATCTATGGTGGTGCTCCCAAAGGACCACAGATTCGTGATTTGGAAAGAGGTGTGGAAATCTGTATTGCAACACCTGGAAGACTGATTGACTTTTTAGAGTGTGGGAAAACCAATCTGAGAAGAACAACTTACCTTGTCCTTGATGAAGCTGATAGGATGCTTGATATGGGATTTGAACCCCAGATAAGGAAAATTGTGGATCAAATAAGACCTGATAGGCAAACACTAATGTGGAGTGCAACTTGGCCAAAAGAAGTAAGACAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATCAATATTGGTGCACTGGAACTGAGTGCAAACCATAACATTCTTCAGATTGTGGATGTATGTCATGATGTCGAAAAGGATGAAAAGCTTATTCGTCTGATGGAAGAAATCATGAGTGAGAAGGAGAATAAAACTATTGTTTTTGTTGAAACCAAAAGAAGATGTGATGAACTTACCAGAAAAATGAGGAGAGATGGGTGGCCTGCCATGGGCATCCATGGTGACAAGAGTCAGCAGGAACGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACCGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGCAGTACCAAAACAGGCACAGCATACACTTTCTTTACACCTAATAACATAAAGCAAGTGAGCGACCTTATCTCTGTGCTTCGGGAAGCTAATCAAGCAATTAATCCCAAGTTGCTTCAGTTGGTCGAAGACAGAGGTTCAGGTCGTTCCAGGGGTAGAGGAGGCATGAAGGACGATCGTCGTGACAGATACTCTGCAGGCAAAAGGGGTGGATTTAATACCTTTAGAGACAGGGAAAACTATGACAGAGGCTACTCTAATCTGCTTAAGAGAGATTTTGGGGCTAAAACTCAGAATGGTGTTTACAGTGCTGCAAATTACACCAATGGGAGCTTTGGAAGTAATTTTGTATCTGCTGGCATACAGACCAGTTTTAGGACTGGTAATCCAACAGGGACTTACCAGAACGGTTATGATAGCACTCAGCAATATGGAAGTAATGTTGCAAATATGCACAATGGTATGAACCAACAGGCATATGCATATCCTGCTACCGCAGCTGCTGCGCCTATGATTGGCTATCCCATGCCAACAGGGTATTCTCAATAAGACTTTAGAAGTATATGTAAATGTCTGTTTTTCATAATTGCTCTTTATATTGTGTGTTATCAGACAAGATAGTTATTTAAGAAACATGGGAAATGCAGAAATGACTGCAGTGCAGCAGTAATTATGGTGCACTTTTTTCGCTATTTAAGTTGGATATTTCTCTACATTCCTGAAACAATTTTTAGGTTTTTTTTGTACTAGAAAATGCAGGCAGTGTTTTCACAAAAGTAACTGTACAGTGATTTCAAATACAATAAATGAAGGCAATGCATGGCCTTCCAATAAAAGATATTTGAAGACTGAATTAAGTGAAATTGTACTTTATTTTACATATATAATGTCATGTACAACTTGGCTTAGATAGTGTTTTTGGGGGGGATTTTTGTTTTGGTGTTTATTTTTACACAAGGAAAGTTGACTACTTCCCATTCCTGGATTTAGGAGAGGAACTCAGAAGGCCCTTAGGATGATCTGTTTGTATGGGAAGAAGTTAGAGACAATGGATTTTATAATTCCAGATTTATTGGATAAAAGCTTTGTCATTTTTCAGTATCAGGGAAGTAAGTCATTTAATAGCCTATTTTCCTTAAGAGTGAACTACAGGACAGTAACTATATAAATACATGTTGATTTCTTTTGCAAAACAGTTTTAAGTAATGACATTTTTGCTTTATCAAAATTTTATTCCATCTCTTGGTTTTGTTGTCAACTGCCGAAATGTGCGAAGCTGAAAGACTGTTAGCCCAAGAGCTGTGTGCACTGTGTCTTTAGTGCAGGATTACCTTGTAGGTTCCTAGTCCTCGAGGACTTGCCAGAGTGCTTATAGCCACACCTGGAAGTCAGGAATGTCTCCACATTATTTCAGGGGATTTTAGGGGTCTTGTAGGCTAGTCACAAGGAAGACGACATAACCAAAAGCACAGTAAAGTTTTCGGGTTAGGTTCACTATGGGCTTAACAGCTAGAAGGATTGGGGGGAAAGCTTTAGATTTAAGTAGGATCACCAGCAAACAGCTTTGTTTCAGAATGGCTATAAGTAGGTCTAAATGTCTTCCCAAAAAATTGGTGTGTTTTTTGCCCAGGACAAAAGTCTTAAAGGAAGTTATTTAACTTTTTGTTTTTAAAATGGGCTTATTGTTAATGCCTTATTTATAAAATGTTAAAACAAAATAGAATGTGCTGGGGGTGGGAGCTGGGCGTGTTTTCCAGGGCTGATAACATTGAAAACTGGTTCATCCTCTAGTACTGAGTGGTTTTCAATGGCATGGCTAGTCAGATTCATGATTTTTAAGTATAGGTGTAGATTGGAGCATTTATTACATATTTTACTGTTCAATGTCTTAATGTGGACCTTTTATTTTGTAAATAATTATGGAAATGATTGTGGGGCTTGGAAAAAATTACCTTTGAAGTTTTAAAAGACAGTCCACTTTTTAGCATGTGTGTTGTGTCCAGCCTGTGGTTGTCTTAACTAATAAATGTGATTTTTC