Transcript asmbl_10410

Sequence
Transcript Sequence for observation asmbl_10410 of TGE0031724:
GTCGAACTCGGTCGAGCCGACGGGAGGAGGAGGGGGCAGACACTAGCGAGCGGGGAAGGAGGGGTGGAAGAGGGAGGGACGTTAAAACGGCTTCTCGACGCTGATTGGACAGCAGAGGAGCACTTCCTCGCAGCACGCGCTGAGGCGGCAGTTTGCGGGCTCCAGATACCATTCCCCGCGGTCAAGATCCCGCTTACGGGTTCTCAGATCGGCGGGCAGGGCAGCCAGGTCACCCAGCAGCCCGGCCGATCTCCCCGGGGGCGTTGGAGCCGCGCTTCCGCTCCGGCCCTCGACACCACCGGCCCCTCCGCTGGTGACGCCCCCGCAGAGGCTTCGCCGTCGCCGAGGCCTTCTCTCCGCGACTCGTCGCCGCAGGATTCTACTTTCACTGGGTTCCGCCCGCACACCGCCACCATTGACGCCATGTCGAGTTATTCTAGTGACCGAGACCGCGGCCGGGATCGAGGGTTTGGTGCACCTCGATTTGGAGGGAGTAGAACAGGACCCCTCTCTGGAAAGAAGTTTGGAAATCCTGGGGAGAAACTAGTTAAAAAGAAGTGGAATCTTGATGAGCTGCCCAAATTTGAGAAGAATTTTTATCAAGAACACCCTGATTTGGCAAGGCGCACCGCACAAGAGGTAGATACATACAGAAGAAGCAAGGAAATTACAGTTAGAGGTCACAACTGTCCAAAACCTGTTCTGAATTTTTATGAAGCAAACTTTCCTGCGAATGTCATGGATGTGATTGCAAGGCAGAACTTTACTGAACCCACTGCTATTCAAGCTCAGGGCTGGCCAGTTGCTCTCAGTGGATTGGATATGGTTGGAGTAGCTCAGACTGGATCTGGGAAAACATTATCTTATTTGCTGCCTGCCATTGTACACATAAACCACCAGCCATTCCTAGAGAGAGGTGATGGGCCTATTTGCTTGGTGCTGGCACCAACTCGAGAACTGGCACAGCAGGTGCAGCAAGTGGCTGCTGAATATTGTCGAGCTTGTCGCTTGAAGTCTACTTGCATCTATGGTGGTGCTCCCAAAGGACCACAGATTCGTGATTTGGAAAGAGGTGTGGAAATCTGTATTGCAACACCTGGAAGACTGATTGACTTTTTAGAGTGTGGGAAAACCAATCTGAGAAGAACAACTTACCTTGTCCTTGATGAAGCTGATAGGATGCTTGATATGGGATTTGAACCCCAGATAAGGAAAATTGTGGATCAAATAAGACCTGATAGGCAAACACTAATGTGGAGTGCAACTTGGCCAAAAGAAGTAAGACAGCTTGCTGAAGATTTCCTGAAAGACTATATTCATATCAATATTGGTGCACTGGAACTGAGTGCAAACCATAACATTCTTCAGATTGTGGATGTATGTCATGATGTCGAAAAGGATGAAAAGCTTATTCGTCTGATGGAAGAAATCATGAGTGAGAAGGAGAATAAAACTATTGTTTTTGTTGAAACCAAAAGAAGATGTGATGAACTTACCAGAAAAATGAGGAGAGATGGGTATGTGGTTTCCTGAGTCAAAGCAGACTTAAAAGTACTTTGATCTGGGGCTAGTGTTTTTTGGGAATCATGCGCTGTGATATAGGGGTAATTGTATGGATTCGTTCCAGTGACTTGTAGTAGGCTCTGGGTTGCAATGCTTAGTGGGAAAACACTTGGCCAAGATGAAGTACAGTGGGAATAGATATTGGTAGAGTCTTGACAAGAGTTTTAAGTTGGGTATACTACTGATAATTTAATTCTTGGTATAGGTGGCCTGCCATGGGCATCCATGGTGACAAGAGTCAGCAGGAACGTGACTGGGTTCTAAATGAATTCAAACATGGAAAAGCTCCTATTCTGATTGCTACCGATGTGGCCTCCAGAGGGCTAGATGTGGAAGATGTGAAATTTGTCATCAATTATGACTACCCTAACTCCTCAGAGGATTATATTCATCGAATTGGAAGAACTGCTCGCAGTACCAAAACAGGCACAGCATACACTTTCTTTACACCTAATAACATAAAGCAAGTGAGCGACCTTATCTCTGTGCTTCGGGAAGCTAATCAAGCAATTAATCCCAAGTTGCTTCAGTTGGTCGAAGACAGAGGTTCAGGTCGTTCCAGGGGTAGAGGAGGCATGAAGGACGATCGTCGTGACAGATACTCTGCAGGCAAAAGGGGTGGATTTAATACCTTTAGAGACAGGGAAAACTATGACAGAGGCTACTCTAATCTGCTTAAGAGAGATTTTGGGGCTAAAACTCAGAATGGTGTTTACAGTGCTGCAAATTACACCAATGGGAGCTTTGGAAGTAATTTTGTATCTGCTGGCATACAGACCAGTTTTAGGACTGGTAATCCAACAGGGACTTACCAGAACGGTTATGATAGCACTCAGCAATATGGAAGTAATGTTGCAAATATGCACAATGGTATGAACCAACAGGCATATGCATATCCTGCTACCGCAGCTGCTGCGCCTATGATTGGCTATCCCATGCCAACAGGGTATTCTCAATAAGACTTTAGAAGTATATGTAAATGTCTGTTTTTCATAATTGCTCTTTATATTGTGTGTTATCAGACAAGATAGTTATTTAAGAAACATGGGAAATGCAGAAATGACTGCAGTGCAGCAGTAATTATGGTGCACTTTTTTCGCTATTTAAGTTGGATATTTCTCTACATTCCTGAAACAATTTTTAGGTTTTTTTTGTACTAGAAAATGCAGGCAGTGTTTTCACAAAAGTAACTGTACAGTGATTTCAAATACAATAAATGAAGGCAATGCATGGCCTTCCAATAAAAGATATTTGAAGACTGAATTAAGTGAAATTGTACTTTATTTTACATATATAATGTCATGTACAACTTGGCTTAGATAGTGTTTTTGGGGGGGATTTTTGTTTTGGTGTTTATTTTTACACAAGGAAAGTTGACTACTTCCCATTCCTGGATTTAGGAGAGGAACTCAGAAGGCCCTTAGGATGATCTGTTTGTATGGGAAGAAGTTAGAGACAATGGATTTTATAATTCCAGATTTATTGGATAAAAGCTTTGTCATTTTTCAGTATCAGGGAAGTAAGTCATTTAATAGCCTATTTTCCTTAAGAGTGAACTACAGGACAGTAACTATATAAATACATGTTGATTTCTTTTGCAAAACAGTTTTAAGTAATGACATTTTTGCTTTATCAAAATTTTATTCCATCTCTTGGTTTTGTTGTCAACTGCCGAAATGTGCGAAGCTGAAAGACTGTTAGCCCAAGAGCTGTGTGCACTGTGTCTTTAGTGCAGGATTACCTTGTAGGTTCCTAGTCCTCGAGGACTTGCCAGAGTGCTTATAGCCACACCTGGAAGTCAGGAATGTCTCCACATTATTTCAGGGGATTTTAGGGGTCTTGTAGGCTAGTCACAAGGAAGACGACATAACCAAAAGCACAGTAAAGTTTTCGGGTTAGGTTCACTATGGGCTTAACAGCTAGAAGGATTGGGGGGAAAGCTTTAGATTTAAGTAGGATCACCAGCAAACAGCTTTGTTTCAGAATGGCTATAAGTAGGTCTAAATGTCTTCCCAAAAAATTGGTGTGTTTTTTGCCCAGGACAAAAGTCTTAAAGGAAGTTATTTAACTTTTTGTTTTTAAAATGGGCTTATTGTTAATGCCTTATTTATAAAATGTTAAAACAAAATAGAATGTGCTGGGGGTGGGAGCTGGGCGTGTTTTCCAGGGCTGATAACATTGAAAACTGGTTCATCCTCTAGTACTGAGTGGTTTTCAATGGCATGGCTAGTCAGATTCATGATTTTTAAGTATAGGTGTAGATTGGAGCATTTATTACATATTTTACTGTTCAATGTCTTAATGTGGACCTTTTATTTTGTAAATAATTATGGAAATGATTGTGGGGCTTGGAAAAAATTACCTTTGAAGTTTTAAAAGACAGTCCACTTTTTAGCATGTGTGTTGTGTCCAGCCTGTGGTTGTCTTAACTAATAAATGTGATTTTTC