Transcript asmbl_10259

Sequence
Transcript Sequence for observation asmbl_10259 of TGE0031697:
GGCGGGGCGAGCGCGGGACAAAGGGAAGCGAAGCCGGAGCTGCGGGCGCCTGCTCGGCCCGCGGAAAGACCATCTTATGCCCCACCTCCCACCCCAGCTCCTGCAACACAAATGCCCAGCACACCAGGGTTTGTGGGATACAATCCATACAGTCATCTCGCCTACAACAACTACAGGCTGGGAGGGAACCCGGGCACCAACAGCCGGGTCACGGCGTCCTCTGGCATTACGATTCCAAAGCCTCCAAAGCCACCAGATAAGCCGCTGATGCCCTACATGAGGTACAGCAGAAAGGTCTGGGACCAAGTAAAGGCTTCCAACCCTGACCTAAAGTTGTGGGAGATTGGCAAGATTATTGGTGGCATGTGGCGAGATCTCACTGATGAAGAGAAGCAAGAATATTTAAACGAATACGAAGCAGAAAAGATAGAGTACAATGAGTCTATGAAGGCCTACCATAATTCCCCTGCGTACCTTGCCTATATTAATGCAAAAAGTCGTGCGGAAGCTGCATTAGAGGAAGAAAGTCGACAGAGACAGTCTCGCATGGAGAAAGGAGAACCTTACATGAGCATTCAGCCTGCTGAGGATCCAGACGACTATGATGATGGCTTTTCAATGAAGCACACAGCCACTGCCCGTTTCCAGAGAAACCACCGTCTCATCAGTGAGATCCTCAGTGAGAGTGTGGTACCTGATGTGCGGTCGGTTGTCACAACAGCTAGAATGCAGGTCCTCAAGCGACAGGTCCAGTCTTTAATGGTTCATCAGCGGAAACTAGAAGCCGAGCTCCTTCAGATAGAGGAACGACACCAGGAAAAGAAGAGGAAATTCCTGGAAAGCACGGACTCCTTTAACAATGAACTTAAAAGGTTATGTGGTCTGAAGGTGGAAGTAGACATGGAGAAGATTGCGGCTGAGATCGCACAGGCGGAGGAACAAGCCCGCAAGAGGCAAGAGGAGAGGGAGAAGGAGGCAGCAGAGCAGGCTGAGCGCAGTCAGAGCAGCATGGCCCCTGAGGAAGAGCAAGTGGCGAACAAAGCCGAGGAGAAGAAAGATGAGGAGAGCATCCCGATGGAGACAGAGGAGACACACCTTGAAGACACAGCAGAGAGCCAGCAGAATGGTGAAGAAGGCACGTCTACTCCTGAGGACAAGGAGAGTGGGCAGGAGGGGGTTGACAGCATGGAGGTGGAAGGGACCAGTGACAGTAACACGGGCTCAGAGAGCAACAGCGCCACAGTGGAGGAGCCGCCCACAGACCCAGTGCCAGAAGACGAGAAGAAGGAGTAAATGTTGCCTTGTTTTATGTGACCTAAAACTTTTTTAAATGAAAAAAAAATGTGGTTTTTTTTTTGGTTTTAATGGTGTTATGTGGTCTGTGTATTAATTATTTACTTTTCCGTTGATACAACATGAAGGTCTTTGAACCCTCAGCATCATAGCCTAATGCCAGCCGCTCACCTTTCTTAGCTCTCAACGTCTGAAACCTCAGAGCTGAGATTAATCAAGACACCCATCATTCTCTGAGAACTACCTTGGCTGCTGCAGAATCGACTCTTCCAAATACCTGCCTTCAGCTCACGTGGTGCTCACCAAAGCCATAGCTTTAAACCCTTCCAGCCCATCCACAGCTTTCCCAGTCCCTGTCTTGTGTACTTACACAGAGTGCCCTCTTGAAATCATGAGGGGGTCTCTTCACTCACCCTTTCTATGTCCCATGTCAGACACCAGGAGTTCTCTTACAGGGTAGGGTGTAGCCAGAAACTGGTGAGACACAGATCACAGAGATGCCTCTGGGGGCACTGGGGGTGGG