Transcript asmbl_10215

Sequence
Transcript Sequence for observation asmbl_10215 of TGE0031689:
GAAAAAATCAACACTGCCATCCAGGACATGCCAGAGAGCCAGGAGATTGCCCAGCTGCTCTCTGGATCCTACATTCATTACTTCCACTGCCTAAGAATAGTGGACCTTCTTAAAGGCACCGAGGCGTCCACCAAAAATATTTTTGGCCGGTACTCTTCACAACGGATGAAAGATTGGCAGGAGATCGTAAGCCTGTATGAGAAGGACAACACCTATTTAGTGGAACTCTGTAGCCTCCTGGTTCGGAATGTCAGCTATGAGATCCCCTCGCTGAAGAAGCAGATTGCCAAGTGCCAGCAACTGCAGCAAGAATACAGCCGCAAGGAGGAGGAGGGCCAGGCTGGGGCCGCTGAGATGCGAGAGCAATTCTACCACTCCTGCAAACAGTATGGCATCACGGGAGACAATGTCCGAAGAGAACTTCTGGCCCTGGTGAAGGACCTGCCAAGTCAGCTGGCTGAGATAGGGGCAGGGGCTCAGTCCCTGGGGGAGGCCATTGACCTGTACCAGGCCTGTGTGGAGTTTGTGTGTGACAGCCCCACAGAGCAAGTGCTGCCCATGCTGCGGTATGTGCAGAAGAAGGGAAACTCGACGGTGTATGAGTGGAGGACGGGGACAGAGCCCTCTGTGGTGGAGCGACCACAGCTGGAGGAGCCTCCTGAGCAGGTGCAAGAGGATGAGATCGACTGGGGTGACTTTGGGGTGGAAGCTGTTTCCGACTCTGGCATCGTTGCTGAGACTCCTGGAATAGACTGGGGTATCTCCCTGGAGTCAGAGGCCAAGGATGCTGGGGCTGACAAGATAGACTGGGGTGACGATGCTGCTGCTGCTTCAGAGATCACCGTGCTGGAGACAGGAACTGAGGCTCCGGAGGGTGTAGCTCGGGGCTCAGACGCTCTGACTCTTCTGGAATACCCTGAAACTCGGAATCAGTTCATTGATGAGCTCATGGAGCTTGAGATCTTCTTGTCTCAGAGAGCAGTAGAGATGAGCGAGGAGGCCGACATCCTGTCCGTGAGCCAGTTCCAGCTGGCTCCTGCCATCCTCCAGGGCCAGACCAAAGAGAAGATGCTCAGCCTGGTGTCCACGCTGCAGCAGCTGATCGGCCGGCTCACCAGTCTGCGGATGCAGCACCTGTTTATGATTCTGGCCTCGCCAAGGTATGTGGACCGAGTGACAGAGTTCCTCCAGCAGAAGCTGAAGCAGTCGCAGCTGTTGGCTTTGAAGAAGGAGCTGATGGTGGAGAAGCAGCAGGAGGCGCTTCAGGAGCAGGCAGCTCTGGAGCCCAAGCTGGACCTGCTGCTGGAGAAGACCAGAGAGCTGCAGAAACTGATTGAAGCCGACATCTCCAAGAGATACAGTGGCCGTCCTGTGAACCTGATGGGGACCTCTCTGTGACGCGCTCCCTCTGTGTCCTCCACCCTCCTTCCCAGCTACCAGGAGGAGGTGGGACAGCCCAGGCTGATGCTACTGGGCCTCACCAGCAAGAAGTCAGGCGGACTTGGAGACAGAGCCATGAGGAAGGGTCACACCATGATCTCTGCAAGCAGTTGTCTTGAGTGGCTCTGGCCTGTCAGCCTTAAGGCACACTTGCTGCTTCTAGTTGTCAAGTGAGGCTTAATAAAAGGAAGTGACTCTCCTTCGTGGCTGGCAGTCACTTGCACCACCACGCTGA