Transcript asmbl_10124

Sequence
Transcript Sequence for observation asmbl_10124 of TGE0031675:
TGGAGCCCAGCGGCGGGTGTGAGAGTCGGTGTTGTGAGCCGCTTCCAGGATCCTGCGATCCGGAGAAGCCGGGGTCTGAGCGGCTCCTCCAGAGTTCCTGATCTATGAAATGGCAGAGAATGGAAAAAATTGTGACCAGAGACGCATAGCAATGAGTAAGGATCAGCACAATGGAAGTCTCACAGACCCCTCTTCAGTTCATGAGAAGAAGAGAAGGGATCGGGAAGAAAGACAGAATATTGTCCTGTGGAGACAGCCACTCATTACCTTGCAGTATTTCTCTCTGGAAACTCTTGTAGTTTTGAAGGAATGGACCTCAAAATTGTGGCATCGTCAAAGCATTGTGGTGTCCTTTTTACTGCTGCTTGCTGCGCTTGTAGCTACGTATTATGTGGAAGGAGCGCACCAACAGTATGTGCAGCGGATAGAGAAGCAGTTTCTTTTGTATGCATACTGGATAGGCCTGGGGATTTTGTCCTCTGTTGGTCTTGGAACAGGACTGCACACCTTTCTGCTTTATCTGGGCCCACATATAGCTTCAGTTACATTAGCTGCTTATGAATGCAATTCGGTGAATTTCCCTGAGCCACCCTATCCTGACCAGATTATCTGCCCAGAGGAAGAAGGCGCTGAGGGAGCCATTTCTTTGTGGAGTATCATCTCAAAAGTTAGAATTGAAGCCTGCATGTGGGGCATTGGAACAGCCATTGGAGAGCTGCCTCCATATTTCATGGCCAGGGCAGCTCGCCTCTCAGGTGCTGAACCAGATGATGAAGAGTATCAGGAATTTGAAGAAATGCTGGAACATGCAGAGGCTGCACAAGACTTTGCATCACGGGCTAAACTGGCAGTTCAAAAACTAGTACAGAAAGTTGGATTTTTTGGAATTTTGGCCTGTGCTTCTATTCCAAACCCCCTGTTTGACCTGGCTGGAATAACGTGTGGGCACTTCCTTGTACCTTTCTGGACCTTCTTTGGTGCAACCCTGATTGGGAAAGCAATCATTAAAATGCATATCCAGAAAATATTTGTTATAGTAACTTTCAGCAAGCACATCGTGGAGCAGATGGTGACTTTCATTGGTGCTGTCCCCGGCATAGGTCCGTCTCTGCAGAAGCCTTTTCAAGAGTACCTGGAGGCGCAGCGGCAGAAGCTTCATCACAGAAGTGAAGCGGGCACACCGCAGGTGAGGATCCCTCCTGCTTCTCCCCCCTCGGCAGGCATCAGCAGGCTCAAACTAGATCCGGAGCTCTCCGGGTTTTAGATGGGGTGGCTGAGGGAGTTTATTGGTCTATGTCTAGTGGCTTTTCAGAAACAAGGATGGGGTAATGGAAGAC