Transcript asmbl_9910

Sequence
Transcript Sequence for observation asmbl_9910 of TGE0003530:
TTTTTTTAGCATCCATTGAATTTATTCGACGTAACCACAGAGGTACCGTCTTCATACCGCCACACAGACACAAACACAGCCACAGCACAATGTCCATATCGGCGCAGGCGCACTCCTTCTGCGGCTCATTTATACGTCTTCATGTGCCACAGTCCGTCGTTTAGATAATGGATATTTTCGATGCCGATCCCCTTGTTGACTTTCTCGATGTCTTCCGCAGACATCTTCATGACTCCGACACACAGGGCGTGCTGTTTTCCTTCCGCCATGATGGCCACCACCGTATCCACCGCGGCAGGGTACAGCTTGGCCCCGGGAGACGTCAGGCCTGGACACATGATGTTCGCGCCACTGAGGACAAATTTGATGGCTCCTTTATCCACCTGCTGGCGCGGCAGGATAAACGGGTACTTGTGGAGCAGCCTCAGCGTCGGGTAAAAAGGCCCTTCTCTTTGTCTAAAAAACAGCAGCTCCCCGTTGACCGTGAGGATCTCTATGTGCTCGTGGCACCGCACTATTTTGACGGGGTCTTTCTTGGGCATGATTTGGTTAAGCCACGGTTCGATGCCTGGAAACTGCTCTGTCAACTGGTTCTTAATGCCCTTAATAACGGACGTTTTCAGCTGGATGCAGTTGGACACGTTTTCCTTCTCGTCGAATTTCTTGAACATGATCCAAGGTGAAGGGGGCGACAGTACGGAAACGCCCGCAACCAGGGAAAAGCTGATCCCGCGAGGCTCGGGCAGGAGCGCTTACCCGCGGAGCGCCGGCGAGACGG