Transcript asmbl_9843

Sequence
Transcript Sequence for observation asmbl_9843 of TGE0003521:
NNNNNNNCCGCCGCGCCGCACAAAGAGCCCAGGGCCGGCCGGCCTTTAAAGGTGGCAGCCTGCGATTTAAGGTGTCCCCGAGTTCCGTGGCCCGCGCTCCGGCGGCCTCGACGTGTGCTTCTATGCGAGCGCCTGGCCGCTGCACCCACGTTGCCGCGGCCCCCCCATTGTTGATGTCCTGAGTTTAGGAGCTTGGGGGGTAGGTGGATCTGTAGAGAGACCAGCTGACTAGGAGAGGGAGGGGAGGAGCCCAGCTGTGAGGTGTGTGAGCCTAAGAACCATGTCTACGCGGGAGTCCTTTAACCCAGAAAGTTATGAATTGGACAAGAGCTTCCGGCTAACCAGATTCACTGAACTGAAGGGCACTGGCTGCAAAGTGCCCCAAGATGTCCTGCAGAAATTGCTGGAATCCTTACAAGAGAACCACTTCCAAGAAGATGAACAGTTTCTGGGAGCAGTTATGCCAAGGCTTGGCATTGGGATGGATACTTGTGTCATTCCTTTGAGGCATGGTGGTCTTTCCTTGGTTCAAACCACAGATTACATTTATCCTATCGTCGATGACCCTTACATGATGGGCAGGATAGCATGTGCCAATGTTCTCAGTGACCTCTATGCAATGGGGGTCACAGAATGTGACAATATGCTGATGCTCCTTGGAATCAGTAATAAAATGACCGACAGGGAAAGGGATAAAGTGATGCCCCTAATTATACAGGGTTTTAAAGATGCAGCAGAGGAGGCAGGAACGTCTGTAACGGGCGGCCAAACAGTGTTAAACCCCTGGATTGTTTTGGGAGGAGTGGCTACAACTGTCTGCCAGCCCAATGAATTCATCATGCCAGATAACGCAGTGCCTGGGGACGTGCTAGTGCTGACGAAGCCCCTGGGGACGCAAGTGGCCGTGGCCGTGCACCAATGGCTGGATATTCCTGAAAAATGGAATAAAATTAAATTAGTGGTGACCCAAGAAGACGTGGAGTTGGCATACCAGGAGGCCATGATGAACATGGCAAGGCTCAACAGGACAGCTGCGGGACTCATGCACACGTTCAACGCCCACGCCGCCACCGACATCACGGGCTTCGGGATTCTGGGCCACGCGCAGAACCTGGCCAAACAGCAGAGGAACGAGGTTTCCTTCGTGATTCACAACCTCCCCGTCCTGGCCAAGATGGCTGCTGTGAGCAAGGCCTGTGGGAACATGTTTGGCCTCATGCATGGGACCTGCCCCGAGACATCAGGTACAAGGATCCTGGGCCCAAATCCGAGGATTAACTAGTGAGGCTAATGGAAAGTGCCATGAGAAGGAAGAAGCCAAGAGGCCTTCTAATCTGTTTACCA