Transcript asmbl_9805

Sequence
Transcript Sequence for observation asmbl_9805 of TGE0003509:
GCGCGACCCGGGGAACCGGCATTGGATTGGCGTCTCTCCCTCATTATGCTGGGCTGGGGAGAAAGGCGAATGGCCTAGTGGTCAGCAGCATGGATTGCAAGCCAGACCACCTGGGTTCAGATCTTAGCTCTGACAGCTCTGTGACCTTGGATGTCCAGCTCGCCGCTGTCCAAGAAACGTCGCGTGTCCGGGCCTGATCCAAAGCCGGGTTCTAACTGTTCCCCCGCCCAGTCTGTGTTGTCCGAAGTGCCCTCGGTGCCAACTAACGGAATGGCGAAGAACGGCAGTGAAGCAGACATAGATGAGGGCCTTTACTCTCGGCAGCTGTACGTGTTGGGCCATGAGGCAATGAAGCGGCTCCAGACATCCAGCGTACTGGTATCAGGCCTGCGGGGCCTGGGCGTGGAGATTGCCAAAAACATCATCCTTGGTGGGGTCAAGGCTGTCACCCTACATGACCAGGGCACTGCCCAGTGGGCTGACCTCTCTTCCCAGTTCTACCTGCGGGAGGAGGACATTGGTAAAAACCGGGCAGAGGTCTCCCAGCCCCGTCTTGCTGAACTCAACAGCTACGTGCCTGTCAGCGCCTACACTGGGCCTCTTGTCGAGGACTTCCTTAGTGGCTTCCAGGTGGTGGTCCTCACCAACACCCCCCTGGAGGACCAGCTTCGGGTGGGTGAGTTCTGTCACAGCCGTGGCATCAAGCTGGTGGTGGCAGACACACGGGGCCTATTTGGACAACTCTTCTGTGACTTCGGAGAAGAAATGATTCTCACTGATTCCAATGGAGAGCAGCCACTCAGTGCTATGGTTTCTATGGTCACCAAGGACAACCCCGGTGTGGTTACCTGCCTGGATGAGGCCCGACATGGGTTTGAGAATGGCGACTTTGTCTCCTTCTCAGAAGTACAGGGCATGGTTGAACTCAACGGAAGTCAGCCCATGGAGATCAAAGTTCTGGGTCCTTACACCTTTAGCATCTGTGACACCTCTCACTTCTCTGACTATATCCGTGGTGGTATCGTCAGTCAGGTCAAAGTACCTAAGAAGATCAGCTTTAAATCTTTGCTGGCCTCACTGGCAGAGCCCAACTTCGTGATGACAGACTTTGCCAAGTTTTCCCGTCCTGCACAGCTGCACATTGGCTTCCAGGCCCTGCACCAGTTCTGTGCTCAGCACGGCCGGGCCCCTCGGCCCCGCAATGAGGAGGATGCAACAGAGCTAGTGACCTTAGCCCAGGCCATGAATGCTCGAGCCCTGCCAGCAGTGCAGCAGGACAGTCTGGATGAGGACCTCATCCGGAAGCTGGCATATGTGGCTGCTGGGGATCTGGCACCCATAAACGCCTTCATTGGGGGCCTGGCTGCCCAGGAGGTCATGAAGGCCTGCTCTGGGAAGTTTATGCCTATCATGCAGTGGCTATACTTTGATGCTCTGGAGTGTCTCCCTGAGAACAAAGAGGCCCTCACAGAGGACAAGTGCCTCCCGCGCCAGAACCGTTACGATGGGCAGGTGGCTGTATTTGGCTCAGACCTACAAGAGAAGCTGGGCAAGCAGAAATACTTCCTGGTGGGTGCAGGAGCCATTGGCTGTGAGCTGCTCAAGAACTTTGCAATGATTGGATTGGGCTGTGGAGAAGGCGGAGAAATTGTCGTCACAGACATGGACACCATTGAGAAGTCAAATCTGAACCGACAGTTTCTCTTCCGGCCCTGGGATGTTACGAAGTTAAAGTCTGACACCGCTGCTGCAGCTGTGCACCAGATGAATCCACACATCCAGGTGACAAGCCACCAGAACCGTGTGGGCCCTGACACAGAGCGCATCTATGACGATGAGTTCTTCCAAAACTTGGACGGTGTGGCCAATGCCCTGGACAATGTGGATGCTCGCATGTACATGGACCGCCGCTGCGTGTACTACCGTAAGCCGCTGCTAGAGTCAGGCACACTGGGCACCAAGGGCAACGTGCAGGTGGTGATCCCCTTCCTGACAGAGTCGTACAGCTCTAGCCAGGACCCGCCTGAGAAGTCCATCCCTATCTGCACGCTGAAGAACTTCCCCAACGCTATCGAGCACACCCTGCAGTGGGCTCGGGATGAGTTTGAAGGCCTTTTCAAGCAGCCAGCAGAAAACGTCAACCAGTACCTCACAGACCCCAAGTTTGTGGAGCGGACCCTGCGGCTGGCGGGCACCCAACCTCTGGAGGTGCTGGAGGCCGTGCAGCGCAGCCTGGTGCTGCAGCGGCCACAGACCTGGGCTGACTGTGTGACCTGGGCTTGTCACCACTGGCACACTCAGTACTCTAACAACATCCGGCAGCTGCTGCACAACTTCCCTCCTGACCAGCTCACGAGCTCAGGAGCTCCGTTTTGGTCTGGGCCCAAACGCTGTCCGCATCCGCTCACCTTTGATGTCAGCAATCCCCTGCATCTGGACTACGTGATGGCTGCCGCTAACCTGTTTGCCCAAACCTACGGGCTGACGGGCTCTCAGGACCGAGCTGCGGTGGCCGCCCTCCTACAGGCTGTTCAGGTCCCCGAGTTCACCCCTAAGTCTGGCGTCAAGATCCACGTCTCTGACCAGGAGCTGCAGAGTGCCAATGCCTCTGTTGATGACAGCCGTCTAGAGGAGCTCAAGGCCACACTGCCTAGTCCAGAAAAGCTCCCTGGATTCAAGATGTACCCCATCGACTTTGAGAAGGATGATGACAGCAACTTCCATATGGATTTCATTGTGGCTGCATCCAACCTTCGGGCAGAGAACTATGACATTCCCCCTGCAGACCGGCACAAGAGCAAGCTGATTGCAGGGAAGATCATCCCAGCCATAGCCACAAGCACAGCAGCTGTGGTTGGCCTTGTGTGTCTGGAGCTCTACAAGGTGGTGCAGGGACACCGACGGCTTGACTCCTACAAGAATGGTTTCCTCAACTTAGCCCTACCCTTTTTCGGCTTCTCTGAACCCCTTGCCGCACCCCGTCACCAGTACTATAACCAAGAGTGGACGTTGTGGGATCGCTTTGAGGTACAGGGGCTGCAGCCTAACGGTGAGGAGATGACCCTCAAACAGTTCCTTGACTACTTTAAGACAGAGCATAAATTGGAGATCACCATGCTGTCCCAGGGTGTGTCCATGCTTTACTCCTTTTTCATGCCAGCTGCCAAGCTCAAGGAACGATTGGATCAGCCGATGACAGAGATCGTAAGCCGTGTGTCGAAGCGAAAGCTGGGCCGCCATGTGCGGGCGCTGGTGCTTGAGCTGTGCTGCAACGACGAGAGCGGCGAGGACGTCGAGGTCCCCTACGTACGATACACCATCCGCTGACCCCCAGCCCCTCCTGTAGACTGGCCCCAGGCCCCCTCTCCAAACCCCTTCCAGCCCAGGGCTCCCAGTTGACCTCTGGCAGTGGCCCAGCTAGCCAAGCCTGGTGTTCCCTCTTCATCCCCCTACTTGAACCCCTCTTGCCGCTGCTTCCTACCTTGTTCAGAACCTGAATCCTAATAAAGAGTTATTAACCCA