Transcript asmbl_28870

Sequence
Transcript Sequence for observation asmbl_28870 of TGE0000916:
GGGTGGCATTGTGTGTCCCGGAGTGCAGGAGCGAGTCCCAGAAGAGAGGCGAGGCTGAGCCCAGAGCGCTGGGCTGCTTCAGCAGGGAAGACTCCCTTCCCCCTGCTTCAGGCTGCCGAGCACTGAGCAGCGCTCAGAATGGAAGCCATCGCCAAGTATGACTTCAAAGCCACTGCAGACGACGAGCTGAGCTTCAAAAGAGGGGACATCCTCAAGGTTTTGAATGAAGAATGTGATCAGAACTGGTACAAGGCAGAACTCAATGGGAAAGATGGCTTCATTCCCAAGAATTACATAGAAATGAAACCACATCCGTGGTTTTTTGGCAAAATCCCCAGAGCCAAAGCAGAAGAAATGCTTAGCAAACAGCGGCATGATGGAGCCTTCCTTATCCGAGAGAGCGAGAGTGCTCCTGGGGATTTCTCCCTCTCAGTCAAGTTTGGAAACGACGTGCAGCACTTCAAGGTGCTCCGGGACGGAGCCGGGAAGTATTTCCTCTGGGTGGTGAAGTTCAATTCTTTGAATGAGCTGGTAGATTATCACAGATCTACATCCGTCTCCAGAAACCAGCAGATATTCCTCCGGGACATAGAGCAGGTGCCACAGCAGCCGACATACGTCCAAGCCCTCTTTGACTTCGACCCCCAGGAGGATGGAGAGCTGGGGTTCCGCCGGGGAGACTTTATCCACGTCATGGATAACTCAGACCCCAACTGGTGGAAGGGGGCGTGCCACGGGCAGACCGGCATGTTCCCCCGCAATTACGTCACCCCTGTGAACCGGAACGTGTAGGAGTCGAGGGGAGAGTATTTAAAGAAAGCGAAACATGGAAAACACGTCCAAAAGAATTCACCCCACGAGCTGCTCTAGCGGCAGCCTGCGAGGGGCTCGGAACACCTTGCCGGGTCACCCGATGACCCTCTCACCTGGTTGGAACTTTGGGGGGTGGGAGGGGGAGTTGGATATAACAATGCCAAAACTTACCTATAAATTAAGAAAAAGAGTTTTTATTACAAATTTTCACCGCTGCTCCTGTTTCTCTTCCTTTGTCCTTTTTTTCATCTCTTTTCCCTTCTGTCCATCAGTGCATGACGTTTAATGCCACATATAGTCCTAGCTGATGCCAATAATAAAAGAAAAGAAACCAAGTGGGCTGGTATTTTCTCTATGCAAAACGTCTGTTTTAGTCAGAATGACTGAAGGAACAGCCGTTGCTGGGCGCTTCATGTACACACGCAGAAGCGGCGGCTTCTGCCCAAGGAGGGGCGGGCGAGTAGGAATCCGCCTTCCAGCCCCCACCCCAGTGTCTCCGTCAAAGTTGGAAACAGAGAGGGGGTGAAAGGAGGCAGCGTTGCCCCTTATGACTTCCTGAGAAAGTCAAGCTGAAACCCGTGTCTCTCTCTCTCCGCGTTTTTCCCTTCCGAATGGTATTACTGAGCATGTCGTTTTTTATAGTGCCTTTTTCCTTATTTCAAGGGTTGCTTATGAGTGGTGTTCTTTTTGTTTTGTTTTAAAATAAGTTAAAGACAGTCTAGAGCTTTTCAGCTGGTGTGTCTCCTACTCTGTGTAAATATTGTTCCCTCAGGGGGAGGGGAGAACAGGGTAGAGAAGAGGAGGCAGGTAGAAGTGCGGGCTGCGGGCATTCTGCGTCCTAAGGCAGGAGAGGTTAAGGTTCAGCTTTGATACCTGTGAGCCCTCCGGAGTTTAAAAGGCCAGGAGCCCAGGGTATCTGGAGTCGCTGCCCGGGCCGCGGTGTGACCAGCTGCCAGGGAAGGAGAGGCGACGGCTCTTCCCACGTTGGACTGGATCTGGCTGAAAGGGGGCTCAGTGACCTTGACCTTGCGGTCTCAGGTGCTGTCTACCCCCTCCTTAATCCTAGAGACCCTTAAGCTGCAAATCCCTCCAGCCAGCAAATTTCAAACACAGGAAAGCCCGAGGAATTTAAACTGTCACTTTGACTATATCGGGATATACCGTATTCCTACGTGGGGGTAGAAAATGAGTCTTCATTTTTCTTGCTCTGAAAGCCAGGGGTATCTGTTCATGCCTTTTACTTTTTGTGTCCCCACCTAACCTGCCCAGATGAGCCTTAGGGCAGCATCCAAGAAGCAGCTGGGTGGTTTTCGGTCTCATTCACAGCGGGCTGTGTTTATAGCTGCTCCACCCCAACCCCGAAACGGAAAGATTTCCGGGAAGCAGGGATAGCTGGGAAGGAAGGCTGGAAATGCAGGAAGGCCAAGCCCACTGCAGAGCGCTCTGTCTCCTGTCAGCTTCTTGCCCCTCGGAGTGATGTGCCTGTGACCTTTCTCTCTTCACCCAGTCCCCTTCTGACCACACCAAGGGGGCCGCAGAGTCATTGATGGCTTTGGGCTCTAACGCGGTCGTGGGCGTCTGCCCTGGACTCTGGTTGTGGAGCCAGACTGGGCCCAGGGCTCTTGGAGGCCCAAGAGGCGGCTGCTCTTCTGGACGGAGCGAGAGGCCTCTCGCTCCCTCTCTTGATAGCTTCTCCCTTCCCCGCTGGTAAAAGGAATCTGGCATTCTACACCTGGACCATTTGATTGTTTTATTTTGGAATTGGTGTATATCATGAAGCCTTGCTGAACTAAGTTTTGTGTGTATATATTTAAAAAAAA