Transcript asmbl_2885

Sequence
Transcript Sequence for observation asmbl_2885 of TGE0004690:
AAACGCCCTCCGGATTAGTGTCGCGCAGGGTGGCGGCTGCACACACAGGCGGTGCAAGACCGCCCGCGCTAGGACCCGCCGGCCCGGAAACGCTTGCTGTCACAAAGGGGGCAACACGTGGGGGCGACGCGTGGGCGCAGACGGCCAGGGCAGCCCGGAGAACCGCCCACTGTCTCGGCCACCTGACTCCTCGGTCCCAGCCGCCAGGTCGGTCCAGCTTCGGCCGGCGCCCGGCTGTGAGGTGGACGCCCGAACTCCGTCTGATCACCTCCCTCCAGTCTTTTCCACCTGGTTCGGACGCCTGCATAATCATGTCCATCCTCTACGTCTCCCCTCACCCCGATGCCTTCCCCAGCCTCCGAGCCCTCATAGCTGCGCGCTACGGGGAGGCTGGGGAGGGGCCGGGGTGGGGAGGGGCCCACCCCCGCATCTGTCTCCAGCCGCCTCCGACGAGCAGGACTCCCTTTCCCCCACCACGTCTGCCCGCCCTGGAGCAGGGGCCCGGTGGGCTCTGGGTGTGGGGGGCTACAGCTGTGGCCCAGCTGCTGTGGCCAGCAGGTCTGGGGGGCCCTGGGGGCAGCCGGGCAGCTGTCCTCGTCCAACAGTGGGTTAGTTACGCAGACACGGAGCTAATACCAGCTGCCTGTGGGGCAACGCTGCCCGCCTTGGGACTCCGCAGCTCTGTCCAGGACCCCCAGGCTGCACTGGGGGCCCTGGGAAGAGCTCTGAGCCCCTTGGAAGAGTGGCTTCGGCTACACACCTACCTGGCTGGGGAGGCCCCCACTCTGGCTGACCTGGCGGCTGTCACAGCTTTGCTGCTGCCTTTCCGATATGTCCTGGACCCCTCTGCCCGCCGGATCTGGGGTAATGTCACTCGCTGGTTTATCACATGTGTCCAGCAGCCAGAATTCCGGGCTGTACTGGGAGAGGTGGTTCTGTACTCAGGGGCCAGGCATCTTTCCCAACAGCCAGGCCCTGAGGTCACTGCACCCCCAAAGACAGCCGGCCAACTCAAGAAAGAAGCAAAGAAACGGGAGAAGCTACAGAAATTTCAACAGAAGCAGAAGATCCAACAGCAGCAGCCACCCCTAGGGGAGAAGAAACCAAAATCAGAGAAGAGGGAGAAACGGGATCCTGGAGTCATTACCTATGACCTTCCAACCCCACCTGGGGAAAAGAAAGATGTCAGTGGCACCATGCCTGACTCCTATAGCCCTCAGTATGTGGAGGCGGCCTGGTACCCTTGGTGGGAGCAGCAGGGTTTCTTCAAGCCAGAGTATGGACGTTCCAGCGTGTCAGCACCAAATCCCCGGGGCATCTTCATGATGTGCATCCCACCCCCCAATGTGACAGGCTCCCTGCACCTGGGCCATGCGCTCACCAACGCCATCCAGGACTCCCTGACCCGATGGCACCGCATGCGTGGCGAGACGACCCTGTGGAACCCTGGCTGTGACCATGCGGGCATTGCCACCCAGGTGGTGGTGGAGAAGAAGCTGTGGCGAGAGCAGGGCCGAAATCGGCATGATTTGGGCCGTGAGGCCTTTCTACGGGAGGTCTGGAAGTGGAAGGAGGAAAAAGGTGACCGGATTTACCACCAGTTGAAGAAGCTCGGCAGTTCCTTGGACTGGGATAGAGCCTGTTTCACCATGGACCCTAAATTGTCAGCAGCTGTGATAGAGGCCTTCGTCCAGCTTCATGAGGAAGGAGTCATCTACCGCAGTACCCGCCTTGTCAACTGGTCCTGCACTCTCAACTCTGCCATCTCCGATATTGAGGTGGATAAGAAGGAGCTGACAGGTCGCACCCTGCTCTCTGTGCCTGGCTACAAGGAGAAGGTGGAGTTTGGGGTCCTCGTTTCTTTTGCCTACAAGGTCCAAGGCTCAGAGAGCAATGAGGAGGTGGTGGTGGCAACAACACGGATTGAGACAATGCTGGGAGATGTGGCCGTAGCTGTACACCCCAAAGATCCCAGATACCAGCACCTGAAGGGGAAGATCTTGATCCACCCATTCCTGTCTCGGAGCCTCCCCATCATCTTTGATGATTTTGTGGACATGGAGTTTGGCACAGGTGCGGTGAAGATCACCCCTGCACATGACCAGAATGACTATGAGGTTGGGCAGAGGCATGGGCTGGAGGCCATCAGCATCATGGACTCCCGAGGGGCCCTCATCAATGTGCCCTTGCCTTTCCTGGGCCTACCCAGGTTTGAGGCCAGGAAGGCAGTGTTGGCGGCACTGAAGGAGCAGGGACTGTTCCGTGGTATTGAGGACAACCCCATGGTGGTGCCACTTTGCAACCGGTCCAAGGATGTGGTAGAGCCTCTACTGCGGCCACAGTGGTATGTGCGCTGTGGGGAGATGGCCCAGGCCGCCAGTGCTGCTGTGACTCGGGGCGACCTTCGAATCCTGCCTGAGACCCATCAGCGGACTTGGCATGCCTGGATGGACAACATCCGGGACTGGTGCATCTCCCGGCAGCTGTGGTGGGGCCATCGCATCCCAGCCTACTTTATCACTGTCAACGACCCAACCATACCCCCAGGGGAGGACCCTGATGGGCGGTACTGGGTGAGTGGGCGCAGCGAGGCCGAGGCCCGTGAGAAGGCAGCCAAGGAATTTGGAGTGTCCCCTGACAAGATCATTCTCCAGCAAGATGAAGATGTATTGGATACCTGGTTCTCCTCTGGCCTCTTCCCCTTCTCCATCCTGGGCTGGCCCAACCAGTCAGAAGACCTGAGTGTGTTCTACCCGGGGACGCTGCTGGAGACGGGCCATGACATCCTCTTCTTTTGGGTGGCCAGGATGGTCATGCTTGGCCTGAAGCTCACTGGCAGGCTGCCCTTCAGAGAGGTCTACCTTCATGCCATCGTGCGAGATGCGCATGGCCGGAAAATGAGCAAGTCTCTGGGCAATGTCATTGACCCTCTGGATGTTATCCACGGAGTCTCCCTGCAGGGCCTCCACGACCAGTTACTGAACAGTAACCTGGATCCCAGCGAGGTGGAGAAGGCTAAAGAAGGGCAGAAGGCGGACTTCCCGGCAGGGATTCCCGAGTGTGGCACTGATGCCCTCCGGTTTGGACTGTGCGCCTACACGTCCCAGGGTACGGGTAGCCCCCAAATCTCTCAGCCCCATTTTTCCTCCTTCCCTAAGGCCCGTCCCTCTCCTCCT