Transcript asmbl_17977

Sequence
Transcript Sequence for observation asmbl_17977 of TGE0000477:
CGCCTCTGAGCCGCGGAGGATTGTGGGAGGAGGTTGTCTCCAATTTCTCCTCCCCCTCCCGGCCAAGATGTCTGACATGGAGGATGATTTCATGTGCGATGATGAGGAGGACTACGACCTGGAATACTCTGAAGATAGTAACTCCGAGCCAAATGTGGATTTGGAAAATCAGTACTATAATTCCAAAGCATTAAAAGAAGATGACCCAAAAGCGGCATTAAGCAGTTTCCAAAAGGTTTTGGAACTTGAAGGTGAAAAAGGAGAATGGGGATTTAAAGCACTGAAACAAATGATTAAGATTAACTTCAAGTTGACAAACTTTCCAGAAATGATGAATAGATATAAGCAGCTATTGACCTATATTCGGAGTGCAGTCACAAGAAATTATTCTGAAAAATCCATTAATTCTATTCTTGATTATATCTCTACTTCTAAACAGATGGATTTACTGCAGGAATTCTATGAAACAACACTGGAAGCTTTGAAAGATGCTAAGAATGATAGACTGTGGTTTAAGACAAACACAAAGCTTGGAAAATTATATTTAGAACGAGAGGAATATGGAAAGCTTCAAAAAATTTTACGCCAGTTACATCAGTCGTGCCAGACTGATGATGGAGAAGATGATCTGAAAAAAGGTACACAGTTATTAGAAATATATGCTTTGGAAATTCAAATGTACACAGCACAGAAAAATAACAAAAAACTTAAAGCACTCTATGAACAGTCACTTCACATCAAGTCTGCCATCCCTCATCCACTGATTATGGGAGTTATCAGAGAATGTGGTGGTAAAATGCACTTGAGGGAAGGTGAATTTGAAAAGGCACACACTGATTTTTTTGAAGCCTTCAAGAATTATGATGAATCTGGAAGTCCAAGACGAACCACTTGCTTAAAATATTTGGTCTTAGCAAATATGCTTATGAAATCGGGAATAAATCCATTTGACTCACAGGAGGCCAAGCCGTACAAAAATGATCCAGAAATTTTAGCAATGACGAATTTAGTAAGTGCCTATCAGAATAATGACATCACTGAATTTGAAAAGATTCTAAAAACAAATCACAGCAACATCATGGATGATCCTTTCATAAGAGAACACATTGAAGAGCTTTTGCGAAACATCAGAACACAAGTGCTTATAAAATTAATTAAGCCTTACACAAGAATACATATTCCTTTTATTTCTAAGGAGTTAAACATAGATGTAGCTGATGTGGAGAGCTTGCTGGTGCAGTGCATATTGGATAACACTATTCATGGCCGAATTGATCAAGTCAACCAACTCCTTGAACTGGATCATCAGAAGAGGGGTGGTGCACGATATACTGCACTAGATAAATGGACCAACCAACTAAATTCTCTCAACCAGGCTGTAGTCAGTAAACTGGCTTAACAGAGAACAAGCTTTTACAGACGTCCTTAAGGCAACAGTGCAGAGATGTAATCCTTAAAAGAACTGGGAATGGCAAAACTACTGTCGGTTGATGTGTCCTGAAAATTATTGGAGTTATGGCAGAAGTGCTTTTTTGATCAACTGGTTTGTGTTTTGCTGCTGCATTTATCCCAAGAAAAACAGCTTTAATCTCCAGAAGAAAACCAAAATACCATGGGATTTATGCTGTATTGACATCTTGCCCTAAACGTACAACATCATAGTAATTTGTCATGGGCAACATGACCAGAGAGAAGATTTTTGTCATGATTTTAAATACACTGACACGCTACTGTTGGTTAAATTTAAACATGTTTTACCTGCAGAAATTCTCTCACAAATAACCTGCAATAACTTGAAATGCATACCCTTTTGAACACTTCCTTTTCTCATGTATAAATTAAAATGTTTGCTGCATTTTGCAAAATGTCAATTCTCTAAAAATGTGTCCGTATATTTCTGTACCTGCAGTGTAGTAAAGGTTTAGACGAAACCCCATAATTATAGTGGCATACTGTCACTTAGGTTTCAAGCAGCAAAATAAACAGTGCAGCTCAGAAATTGTAGTTTGGTTCTTGATGTGTTTTTATTACATTTGGAGTTGTTTTGTTTTTTAGTACCTTCGAAATTTCAAATTATTTTATCTTCAGTTAATGATTTTAAAAAGCCTGGGGGCAAATAAG