Transcript asmbl_9143

Sequence
Transcript Sequence for observation asmbl_9143 of TGE0007905:
AGCAACAGCAGCAGCAGCAGCAGCCTCGCCCTCCTCCTCGCCAGCAGGAAAGAGCCCACTTGGAGAGTCTGGGGCTCAGTAGGCCTAGTCCCCAGCTGTTGGCAGAAACCCCTGTGCCTGGCCTCCCTGAGTTCCCACGGGCAGCCTCCCAGCAGGAGATCGAGCAGTCCATCGAAACCCTCAACATGCTGATGCTGGACCTGGAGCCAGCTGCGGCTGCCGCCCCCCTGCACAAATCCCAGAGTGTCCCAGGGGCCTGGCCAGGGGCCTCCCCGCTCTCTTCCCAGCCCTTCTCCGGCTCCTCCTGCCAGTCCCATCCGCTGACCCAGTCCAGATCTGGCTACATCCCCAGTGGGCATTCCTTGGGAACCCCTGAGCCAGCTCCACAGGCCTCCCTGGAGTCCGTCCCTCCTGGCAGGCCTTACTCACCTTATGATTATCAGCCATGTCCGGCTGGGCCCAACCAGAGCTACCGTCCAAAGAGCCCAGCTTCCTCCTCCACGTCCTCTGCCTTCCTTCCAACCACTCACAGCCCTTCAGGGCCTCAGCAGCCTCCGGCATCTCTCCCTGGCCTCACCGCTCAGCCTCAGCTCTCACCAAAGGAAGCGACTTCAGATCCATCCCGAACTCCGGAGGAGGAACCCTTGAACTTGGAGGGGCTAGTGGCCCACCGGGTAGCAGGGGTGCAGGCTCGGGAGAAGCAGCCTGCAGAGCCCCCGGCCCCTCTCCGGAGGCGGGCGGCCAGTGATGGACAGTATGAGAACCAGTCTTCAGAACCCTCATCTCCCCGGAGCCCTGGGGTTCGCTCCCCTGTCCAGTGCGTCTCCCCAGAGCTGGCTCTCACCATCGCTCTTAATCCTGGAGGACGGCCCAAAGAGCCCCATCTGCACAGCTACAAGGAGGCTTTTGAGGAGATGGAGGGAACCTCTCCGACCAGCCCACCGCCCAGTGGGGTGCGCTCCCCTCCAGGTCTGGCCAAGACACCCCTGTCTGCTCTGGGCCTGAAACCCCACAACCCAGCGGACATCCTGTTGCACCCCACAGGTGAGCCTCGGAGCTACGTCGAGTCGGTGGTGCGGACGGCAGTAGCTGGGCCCCGAGCTCAGGACCCTGAGCCCAAGAGCTTTAGCGCCCCAGCTGCCCAGGCCTATGGCCATGAGACGCCCCTGAGGAATGGGACCCTGGGTGGCTCCTTTGTCTCCCCCAGCCCCCTCTCCACCAGCAGCCCCATCCTCAGCGCTGACAGCACTTCAGTGGGGAGTTTCCCGTCAGGAGAGAGCAGTGACCAGGGCCCCCGGACACCCACCCAGCCTTTGCTGGATTCCGGCTTCCGCTCCGGCAGCCTGAGCCAGCCCAGCCCTTCGGCTCAGAGAAGCTACCAGAGTTCTTCTCCTCTCCCGGCCGTGGGCAGCAGCTACAGCAGCCACGACTACTCACTGCAGCAGTTCAACTCCCCAGAAAGCCAGGCCCGGGCTCAGTTTGCTGTGCCCAGCGTCCACACGGTACCCGGGAGCCCTCAGGCACGCCAGAGGACAGTGGGCACCAATACTCCCCCTAGCCCTGGCTTTGGTCGCCGAGCCATCAACCCCAGCATGGCTGCCCCTGGCAGCCCCAGTTTGAGCCACCGCCAGGTGATGGGCCCATCAGGAGCTGGTTTCCATGGTAACACAGTTTCCAGCCCCCAGAGCAGTGCAGCGACCACTCCAGGAAGCCCCAGCCGGGGCCAGCACCCTGGGGCCCACCAGGCCTCAGGCCTCCATGGCAGTGTGGTCACCACTCCAGGGAGCCCAAGCCTGGGCCGGCACCCAGGAACCCACCAGGGCAACCTGGCCCCCAGTCTCCATGGCAACACAATAGCCAGCCCCGGAAGCCCCAGCCTGGGCCGGCACCTGGGAGGATCTGGATCTGTGGTTCCCGGAAGCCCCAGCTTAGACCGGCACGTGGCCTATGGCGGCTACTCCACCCCTGAGGACCGGAGACCCACGCTGTCCCGGCAGAGCAGTGCCTCCGGCTACCAGGCTCCCTCCACGCCCTCCTTCCCTGTGTCCTCTGCCTACTACCCTGGTCTGAGTAGCCCTGCCACCTCCCCCTCGCCGGATTCAGCAGCCTTCCGGCAAGGGAGCCCAACACCGGCCTTGCCAGAGAAGCGGAGGATGTCCATGGGAGACCGGGCGGGCAGCCTCCCCAACTATGCTACCATCAACGGGAAGGTGTCCTCCTCGCCTGTCGCCAGCGGCATGTCCAGTCCCAGTGGGAGCAGCACCGTCTCCTTCTCTCATACTCTGCCTGACTTCTCCAAGTACTCCATGCCAGACAACAGCCCTGAGACCCGGGCTAAAGTGAAATTTGTCCAGGACACTTCCAAGTATTGGTACAAGCCTGAGATCTCTAGAGAGCAGGCCATCGCACTCCTGAAGGACCAGGAACCAGGGGCCTTCATCATCCGTGACAGTCACTCCTTCCGAGGGGCCTATGGGCTGGCCATGAAGGTGTCATCTCCCCCTCCGACCATTATGCAGCAGAATAAAAAAGGGGACATGACCCATGAGCTGGTGAGACATTTCCTGATAGAGACTGGCCCTAGAGGAGTCAAGCTCAAGGGGTGCCCCAATGAGCCAAACTTTGGATCCCTCTCTGCCCTGGTCTACCAGCACTCCATCATCCCACTGGCTCTGCCCTGCAAGCTGGTCATTCCAAACCGAGATCCCACAGATGAATCGAAAGATAGCTCAGGCCCTGCCAACTCAACCACTGACCTGTTGAAGCAAGGGGCAGCCTGTAACGTGCTCTTCGTCAACTCTGTGGATATGGAGTCACTCACTGGGCCACAGGCCATCTCCAAAGCCACTTCTGAGACACTGGCTGCTGACCCCACGCCGGCTGCCACCATTGTTCACTTCAAAGTTTCTGCCCAGGGAATTACACTGACTGACAACCAGAGGAAGCTCTTCTTCAGACGACACTACCCCCTCAACACTGTCACTTTCTGTGACCTGGATCCACAGGAGAGAAAGTGGATGAAGACGGAGGGAGGGGCCCCTGCTAAGCTCTTCGGCTTTGTGGCCCGGAAGCAGGGCAGCACCACGGACAACGCCTGCCACCTCTTCGCTGAGCTTGACCCTAACCAGCCTGCTTCCGCCATTGTCAACTTTGTCTCCAAGGTCATGCTGAGTGCTGGCCAGAAGAGATGAACCCACCCCTTGCCTGGGGCCAGGGCAGTGGGGATGGGGCATGTGGGGGCGGGGAGACCCATGAATCCTGACCACCTTTAAATCCAGAAGGAGGACTTTGGGCTAATTTTGGAGAAGGAGAGAAGAAAGTGCAATGTGGGGAGAGGGAAGTGAATCGCAGAGGGGAGGGGGAGAGCGGGAGAGAAAGAAAGAAAAAGATGGAGGAGGATTACTGGGATTCCTTTGGTTAGATGGATACTACGTAACCCCAAAGCCTCCCAAACTAACCAGGTCCACCTAACTCTCCCTCACCCTCCCAGAAGACAGAGTTTCTCAAAGGAGGCAGAACGGACCTCCTTGGGGATCCATGTTTTGAGGGGAATGGAAAAGCTCTGTCTCCCTAGCCCTGCTTTGCAAGGAGAAATCAAGTTGAGAGAATCTTTTTCCGGCGATCTCTAGGGTAGATTGCCAAACCAAAAAGAGCCAGCATGGGACGTCAAGGGGCAGGACTTTTGTTTTTGAAGGTAACTCAGACCCGAGGCACCTAAGGTCTCTTTGCTCTGTCTCCGATGTATAGTTCATGTGGGTATATATGTAGGGTGTGTATATGTCCACACCCACATCCTCACACACTGATTTATATTTGCCTCTCAGCTCGCATTATAAACAGGTGTACTTGTCCGTGTCCATGCGTTTGCACACACGTGCATATCGTCCAAAGAAGGTTAGAGTTGGGGTGACACAGCAGAGGAAGGGGACATCAGCCCTTCTCCCCAGGAGCACCCAGGAATATGGGTAACAGACTCTGTCTCGGTCCCTGCACCTGCAGCCTAGTAGCCCTGGGTGCCAGCAGGAGCGGGGCCGGCCACCTGCAGCATCCCTGTTCTGCCTTGGCCAGGAGGCAGGAGCACTGATGTGAGGAGATGGGGGACACGAATGCCCATCGCCTTGGGGAAGAGATCCGTCAGCCGTGGTGGCTGCAGAGCTCCGGGCATCTCTCCTGAGGCGTGTGGCCCAGCGGTGAGGTGGCTGGGTCGCTCCTGCCAGTCCCAGGCCTCAGCCCGTCCTTGGGTGCCCCGCCCAGACCAGCCTTATCTCAGACTTGCTTATCTGCATGGTGTCTTATTGGGTGCTGGAGATTGAGCCTTCCTGCTCTGCCCTGCCCTGCTCTGTCCTGCAGGGTCCCCGTGTTGGGCTCATCCAGGGGATCCTGCTTCTAAGAGTCCTGCTCAGCGAGGCCCGGGGGAGACTCCTGTCGTCCTTGTACCCCCGTCTGCAAGTGTTTTGGGGCCCGACTTTTGCTGGGCTGTCCAGGTGACTTAGTAGAGCTCTGGGGGCTGCTACCTGTACACCACATGGCCTACCTACAATACCAAAGCCTTGCTGTTCCCCCTTCTGCCTTGGTTTCCCCAGCAGAGCCAAGCTGCTCGTGAGTGGAGGGCAGAAGGCACACATTTAGGCCAAAGGGCAGTTGGGAACCCCTCAACCTCCACCCAAGGACTCTAAGCTGGAATGGAAAGTCTACCAGGATTCCATTCTTGAGGGGTTTCTTAAGCCTCTGGGGGTCCCCTAGAGAGAGGCATTGTATTGATATATAAATATATATAATATATATGTGAGACATACTGACAGAATCTGTAAGCTAATAAAATATAAGAAAAGGTTAAAAAAAGAATAGGTAAATTGACAAGAAGTATTTATTATTTTCCCATATTGCTTTATTGCCTCCCTGGGCGTAAACCAATTCCCATCCCTCTTGATATGTTTAAGTGAAGCCTGAAATGTGGGGACCTTTTTCTTTGGAGCAATCAGGGGTCTCCTTGCCCTGGCCTTGACCTTCCCCAGACTCTGTCTGGGGCTCAGCGGGGAGGGGTGCACGTGTTCCACCCCCTTTGGCCCCCTTATTTTCTGGCAAGCCCAGGACTCAGCCATCAGCTCCCGAGATGAGAAGAGAGCTGTCTGCTTACTGCGGCTCCGGCCCCAGCGGGCCGGCGGGGGACATGCGTGTTTGTGGCTGGCTTGGGCAATGTGTGCATCTTTTGTATTTTTTTCTCCTCCGAGAAGCTGTGTCTGTGTGGGCCTTCTGTTTCAGGAGAGTGTCTATAGAGTGTCTAAAGTGGGGGCAGCCCCCACTTCCCAAAGATTGAAACCTTGTGCTTGGTGACCAGGCTCCTCCACAGTGCTCTTCCTTCTGAGGGCGTTCAAGCCAGATATCCGGAATTCCCTCTCCTCAGTCCCTCCTACCCCGACTCTCTTCCCAGGTGGGAGATATCCTGCCTCCTCCCTTTGTACATATCTTACCCTCCCACGGGACAGCCCGGGGACACTCTCCTGGTCTGGATGTCCTCGCCACACTTGAGGCCGGGTGGCGTGTGAGACCGTTCTGCGGACCCAGGCCTGGGGTCAGCCTTCTCACGTGCTTTCCCACTGCCCACCACGGCCCATCTCCCAGGCACGGCCAGAGCACCCCACCCAGGCCTGAGCTGAGTGTGACCCTTGGGGTGCCAGGAAGCTGATCGACTCACTCCCTGCTGTTGCTTTGGAAGGAGTCGATTTCCTGGAGCTTGGCCTTTCCGGAAGAATGATGGGGAAGGGCACCTCAGTCTCCACGGTAGCCCCCCACTTTGGGTCAGACACTGGTTGGGAAGACACTGTAGCCCTCCCATGTCTCACAGGTTAGGCCTGTGCACCCATGCG