Transcript asmbl_28820

Sequence
Transcript Sequence for observation asmbl_28820 of TGE0004684:
GGCTGCCGAGAAACAGGTACCTGGAGGCGGCGGCAGCGGCGGCGGCGGGGGCAGCGGTGGCGGCGGACGCGGTGCCGGAGGAGAGGAGAATAAGGAAAACGAACGGCCATCCGCCGGATCGAAGGCAAACAAAGAATTCGGGGATAGCCTGAGTTTGGAGATTCTTCAGATTATTAAGGAATCCCAGCAGCAGCATGGCTTACGGCATGGAGATTTTCAGAGGTACAGGGGCTACTGTTCCCGCAGACAGAGACGGCTCCGGAAAACGCTTAACTTTAAGATGGGGAACAGACACAAATTCACAGGGAAAAAAGTAACCGAAGATCTTCTGACCGATAACAGATATTTGCTTCTGGTTCTGATGGATGCTGAAAGAGCCTGGAGCTATGCCATGCAGCTCAAACAGGAAGCCAACACTGAACCCCGAAAACGGTTCCACCTGTTGTCTCGCCTGCGGAAAGCTGTGAAGCATGCCGAGGAATTGGAACGCTTATGCGAGAGCAATCGCGTGGACGCCAAGACCAAGCTAGAGGCTCAGGCTTACACAGCTTACAAAAAAAAAAGAACATCAAGAGTGGAAAGCTGCCATTGAGGCTTTTAATAAATGCAAAACGATCTACGAGAAGCTCGCCAGTGCTTTTACAGAAGAGCAGGCCGTGCTGTACAGCCAGCGTGTGGAGGAGATCTCGCCCAACATCCGCTACTGCGCGTATAACATTGGGGACCAGTCAGCCATCAATGAACTCATGCAGATGAGATTGAGGTCTGGGGGCACCGAGGGTCTCCTGGCTGAAAAATTGGAGGCATTGATCACTCAGACTCGAGCCAAACAGGCAGCGACCATGAGCGAAGTGGAGTGGAGAGGGAGAGCGGTCCCGGTGAAGATCGACAGAGTGCGGATCTTTTTGTTGGGGTTGGCCGATAACGAAGCAGCCATTGCCCAGGCTGAGAGCGAAGAAACCAAGGAACGTCTGTTTGAGTCTGTGCTCAGCGAGTGTCGGGACGCCATCCAGGCCGTGCGGGAGGAGCTCAAGCCCGATCAGAAGCAGAGAGATTACACCCTCGAGGGAGAGTCGGGGAAGGTGTCTAATCTTCAGTACCTGCACAGCTACCTGACCTACATCAAGCTGTCAACGGCGATCAGGCGGAACGAGAACATGGCCAAAGGTCTGCAGAGGGCCCTTCTGCAGCAGCAGCCGGAAGACGACAGCAAACGCTCCCCCCGGCCGCAGGACCTCATCCGGCTCTACGACATCATCCTGCAGAATCTGGTGGAATTGCTCCAGCTTCCTGGCTTAGAGGAGGACAGAGCCTTCCAGAAAGAGATAGGCCTCAAGACCCTGGTGTTCAAGGCTTACAGGTGTTTTTTCATTGCTCAGTCCTACGTGTTGGTGAAGAAGTGGAGCGAAGCCCTCGTCCTGTATGACAGAGTCCTAAAATATGCAAATGAAGTGAATTCTGATGCTGGGGCCTTCAAGAATAGCCTGAAAGACCTGCCTGACGTGCAAGAGCTTATCACGCAAGTGAGGTCAGAAAAGTGCTCTCTGCAGGCGGCGGCGATCCTGGATGCAAGTGACTCCCACCAAACAGAGACTTCCTCTCAAGTCAAGGAGAATAAGCCCCTGGTTGAGCGGTTTGAGACCTTCTGCCTGGACCCTTCCCTCGTCACTAAGCAGGCCAACCTCGTGCACTTCCCTCCGGGATTCCAGCCCATCCCTTGCAAGCCTTTGTTCTTTGACCTGGCGCTCAACCACGTGGCTTTCCCACCCCTCGAGGACAAGTTGGAGCAGAAGACCAAGAGTGGGCTCACCGGGTACATCAAGGGCATCTTTGGATTCAGGAGCTAACCACTCTTTTCCTTGGGGGCAGGGGGTAATTCTGACTCGGTCTGTATTGTGAGAAAACTCTAGCAAGTCTGTGATATTAAATCCAGGTCTGCGTTGGCCCAGGGCGGGAGTGTAACATCCTCAGCCCTGCGTTCCTATGTCTGTGTGTGTGCGCTCATGTTCTTAACCGGTGTGCCAGGAGGGCACCCTGTTGTCTTCTGGTGGATGTGTGCGGGGTCCCTCTGTCCATACCTCCCGGAGGAGGGCCGCTGCCATCTGGGCCCGTGCGAGCTGTGATTGTTTACCTCTGGTCCGTAACGTGTTCGGGAGGAGGTCCACTCCAGGCACCGCGAGCGCTCGGAAAGCTTTGCTGCGTTTCTTCAGTGCTGTGGACTTAAAACACACTCCTCCTCGCTGTGAGCATCCAGGACCCTTTGGAAAGTTTGTTCGTGACTAGGAAACACTGGCAACGTCCCCCCAGAACGACAGTCAGCCTCCCCCCTTCACTGCCAAGTGAAAGTTCAGAAGTTTCAGAACAAGCAAAGAGCTCTATTTTTAGAAGAAATATGTTATACTCAGAATTGATGAAAACAAATCTTATATTAAAAGGCAAAGATGCTGGA