Transcript asmbl_8411

Sequence
Transcript Sequence for observation asmbl_8411 of TGE0002306:
CCGCTCTGCTGCGGTCGGTTCCTGCGTCCGCTGCTGCCGGTTCCGCCACGCTGCAGGTATTTTTTCCTGAACAAAAGCTGCCTCAACCTATGTTTCAAGGATGGCTCTCCCTATCATTGTAAAATGGGGTGGACAGGAATATTCAGTGACCACACTTTCAGAAGATGATACTGTGCTAGATCTCAAACAGTTTCTCAAGACGCTCACAGGAGTGCTACCAGAACGCCAAAAGTTGCTTGGACTTAAAGTTAAAGGCAAACCTGCAGAAAATGATGTTAAGCTTGGAGCTCTCAAACTGAAACCAAATACTAAAATCATGATGATGGGAACTCGTGAGGAGAGCTTGGAGGATGTCTTAGGTCCACCTCCTGACAATGATGATGTTGTCAATGACTTTGATATTGAAGATGAAGTAGTTGAAGTAGAAAATAGGGAAGAAAACCTACTAAAAATTTCTCGCAGAGTAAAAGAGTACAAAGTGGAAATTTTGAATCCTCCCAGGGAAGGGAAAAAGCTTTTAGTACTTGATGTGGATTATACATTATTTGACCATAGGTCTTGTGCAGAGACTGGCGTAGAATTAATGCGGCCATATCTTCATGAATTCCTAACATCTGCATATGAGGATTATGACATTGTTATTTGGTCTGCAACAAATATGAAGTGGATTGAAGCTAAAATGAAAGAGCTGGGAGTGAGCACAAATGCAAATTATAAAATTACCTTCATGTTGGACAGTGCTGCTATGATAACAGTGCATACACCAAGGAGAGGATTAATAGATGTAAAGCCTCTTGGTGTTATATGGGGAAAGTTTTCGGAATTTTACAGCAAAAAAAACACCATTATGTTTGATGACATAGGAAGAAATTTTCTAATGAACCCACAGAATGGACTAAAGATAAGGCCTTTTATGAAAGCGCATCTAAATCGAGATAAAGACAAAGAACTTTTAAAATTAACTCAGTACCTCAAGGAAATAGCAAAATTGGATGACTTTTTGGACCTAAATCACAAATATTGGGAAAGGTATCTCTCAAAGAAGCAAGGACAGTAGTTACAAGTTATACTGGCAGTTATTGAAGATACTTGAGATCCATGAACTTCTTGCTTTAATGCTAGAAATCATTATAATAGTGCTGGACACTGAAGCAAATACCAGACTGCTTATACTTGGTCTTCCAGTTTTTTGTAAATTTAATTTTATATTTTTTGAAGCTCATGGCAATATGCTAAAAAACAAAAACAAACAAACAAAAAACCCTTTTTTCCCCGGTAAGAATATACTGTTACTCTTGAAAAATATTTTCTCCAGCATTGAGTACTGAGTTTTTTTTCCCACATACACAAAAAAAAGTGGACAAAAATGTATATTCAACAATGTCATTTTGTGACTTTGGAAACAAGTTATGTCTTGTGTTTTTGCCTCCTTGTGGTGTTTGACTAAATCTTAGACCAAACCCATCTTGAAAACTACTGCTCTTCCTTTTAAAACCAAAAAATATCTTTTGAGTAAGGAACCTAGTTTGGTGTTTAAGTTAAAGTCACCAAGAGTTTTTTTCATTCCTTTGTCATAGACACAGTTTCTCTTCTTGCTCCACTATTTACATATCTAAATTCTGAGCTGTCTCAGTTTGGTCTGTATGTGTATCCATGTTCTTTGAGTAAAACTGGAAAATGTCAGCCGTGATACAGATATGTCATAGTATGAAAATTAGAAAACAAGACTGAAGAATAAAATTAAGGAACGAGAGTTTCTTTTTGGTGACTAAGTAGAAGCACTTCTGCCTAAAACCATTGTCATAAAAGCAGTTAAAGGCAATACATTTTTAAATGGGACAAATCATCGATTAAGCCCTAGAAAGCATGAACAAAAAGGTTTTGTTCTGTTCCAGCTATACCTTGTCTAAGTGCAAACACTGTTTCAGTGGAAATATCTAGCCATAAGCTTTAAAAAATTATTTGCAATGCTTAAGCCTGCAGATGTGTAATGTGGCCACTGTTTTGTGTTAACAGTATTGCTTTATACAGTTCTTGTATTTGAAAGGAATCTGATCCTTTCACAGGAACATGGTATATATCGTTCTTACGGGACTATTTCAGTGGTGTAAATAATAAATACCTTTTCTTAAAA